Anarta melanopa

Thunberg, 1791 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anarta

At a glance

Occurrence records4 118

Data sources7

Biological traits2

DNA specimens23

eDNA detections40

Sources7 archives

Databases and archives Anarta melanopa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 118 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 118 records

Environmental DNA3 datasets · 9 countries40 detections

DNA & barcodingBOLD23 specimens

01Narrative

Hadula melanopa, the broad-bordered white underwing, is a moth of the family Noctuidae. The species was first described by Carl Peter Thunberg in 1791. Subspecies H. m. melanopa is found in northern Scandinavia; subspecies H. m. rupestralis is found in the Alps, the Balkan Mountains and the Apennine Mountains; subspecies H. m. brunnea is found in mountainous areas of Great Britain and subspecies H. m. koizumidakeana is found in Japan. Alpine form, H. m. rupestralis

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarta melanopa has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections40

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

160Gvariable

223Cmostly conserved

469Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes5

BIN1

Most divergent pair0.46%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarta nigrolunatasame genus2.6%Anarta trifoliisame genus4.1%Conisania poellisame family4.3%Conisania aridasame family4.3%Conisania leinerisame family4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 118 records

Wild obs. + sensor2 704

Museum / vouchered1 304

Cultivated / captive1

Other109

Origin

Introduced1

Range

Area of Occupancy AOO3 868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 480≤1 km 501≤10 km 1 621>10 km 79

2 681 georeferenced · 23 without coordinates

Open the mapobservation + sensor2 704

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 70≤1 km 364≤10 km 683>10 km 70

1 187 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence1 304

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	673
Provincia di Livornolocation not on record	144
NHMOlocation not on record	76
Salzburg, AT	60
Kuopio, FI	41
NTNU-VMlocation not on record	39
ZMAAlocation not on record	30
SLU Artdatabankenlocation not on record	30
MZLUlocation not on record	18
Durban Natural Science Museumlocation not on record	16
Rovaniemi, FI	13
St. Paul, US	7
Tartu, EE	6
RMZlocation not on record	5
BioFokuslocation not on record	4
CBDClocation not on record	4
Edmonton, CA	2
Natural History Museum Rotterdamlocation not on record	2
NCMGlocation not on record	2
Chicago, US	2
ASUlocation not on record	1
Auckland, NZ	1
Bavarian State Collection of Zoologylocation not on record	1
ZSMlocation not on record	1
Metsähallituslocation not on record	1

25 institutions · 1 179 of 1 304 vouchered records shown · 125 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA40 detections

Where the DNA of Anarta melanopa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys3

Countries9

Verifiable raw sequence linked15

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map9 countries0

Alpine willow zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.20 °C 1.50–11.7

Seasonal swing summer↔winter21.2 °C

Max temp (day)9.90 °C 5.00–15.0

Min temp (night)4.50 °C -3.70–7.00

Precipitation134 mm/mo 88.9–203

Air humidity66.3 % 60.2–68.1

Moisture balance66.6 mm/mo 2.50–93.6

Vapour deficit351 Pa 272–534

Wind speed3.50 m/s 2.70–6.60

Cloud cover62.2 % 37.6–62.5

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anarta melanopa

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type4 118 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 118 records