Anarta nigrolunata

Packard, 1867 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anarta

At a glance

Occurrence records355

Data sources7

Biological traits0

DNA specimens13

eDNA detections13

Sources7 archives

Databases and archives Anarta nigrolunata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility355 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF355 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Anarta nigrolunata is a moth in the family Noctuidae first described by Alpheus Spring Packard in 1867. It is found in the Arctic and alpine regions of Canada. Anarta melanopa was considered a synonym of Hadula nigrolunata, but J. Donald Lafontaine and James T. Troubridge state that there are "numerous consistent differences that warrant recognizing them as separate species".

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarta nigrolunata has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

375Gmostly conserved

478Tmostly conserved

616Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarta melanopasame genus2.6%Anarta sabulorumsame genus3.0%Anarta dianthisame genus3.3%Anarta collettisame genus3.5%Conisania aridasame family3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type355 records

Wild obs. + sensor46

Museum / vouchered309

Range

Area of Occupancy AOO516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 17≤1 km 12≤10 km 9

38 georeferenced · 8 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 9≤1 km 81≤10 km 84>10 km 4

178 georeferenced · 131 without coordinates

Open the institutions mapphysical evidence309

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	126
University of Alberta Museums (UAM)location not on record	68
Cambridge, US	38
New Haven, US	30
East Lansing, US	11
Helsinki, FI	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Edmonton, CA	6
OSUClocation not on record	2
Vernal, US	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
ASUlocation not on record	1
WWUlocation not on record	1

13 institutions · 300 of 309 vouchered records shown · 9 without an institution code

09Environmental DNA13 detections

Where the DNA of Anarta nigrolunata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

GrasslandAlpine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.40 °C -3.30–11.4

Seasonal swing summer↔winter27.4 °C

Max temp (day)14.7 °C -0.6–15.6

Min temp (night)3.80 °C -7.20–7.00

Precipitation77.5 mm/mo 52.7–91.4

Air humidity58.9 % 54.8–63.9

Moisture balance-18.8 mm/mo -81.9–9.10

Vapour deficit510 Pa 215–606

Wind speed4.40 m/s 2.30–5.20

Cloud cover41.9 % 34.9–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)