Anadara inaequivalvis

(Bruguière, 1789) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Arcida/Arcidae/Anadara

At a glance

Occurrence records468

Data sources7

Biological traits8

DNA specimens13

eDNA detections10

Sources7 archives

Databases and archives Anadara inaequivalvis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility215 records↗

OBISOcean Biodiversity Information System253 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS468 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD13 specimens

01Narrative

Anadara inaequivalvis is een tweekleppigensoort uit de familie van de Arcidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1789 door Bruguière.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length9.5 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max30 m

Depth min0 m

Vulnerability10

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anadara inaequivalvis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P427 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Diversity (π)2.7%

Haplotypes2

BIN1

Most divergent pair0.23%

Where individuals differ — all 68 variable positions, in barcode order

1Tmostly conserved

4Gmostly conserved

7Gmostly conserved

10Amostly conserved

19Cmostly conserved

22Tmostly conserved

25Cmostly conserved

34Amostly conserved

40Cmostly conserved

58Amostly conserved

67Cmostly conserved

73Cmostly conserved

79Gmostly conserved

85Gmostly conserved

88Tmostly conserved

94Cmostly conserved

97Gmostly conserved

100Gmostly conserved

103Amostly conserved

106Tmostly conserved

109Tmostly conserved

112Tmostly conserved

113Tmostly conserved

121Gmostly conserved

133Tmostly conserved

135Gmostly conserved

139Tmostly conserved

142Amostly conserved

149Gmostly conserved

154Amostly conserved

156Tmostly conserved

157Amostly conserved

158Amostly conserved

166Tmostly conserved

172Cmostly conserved

175Tmostly conserved

203Gmostly conserved

214Amostly conserved

217Tmostly conserved

230Amostly conserved

231Gmostly conserved

259Gmostly conserved

277Gmostly conserved

283Amostly conserved

293Tmostly conserved

301Amostly conserved

302Cmostly conserved

304Amostly conserved

308Tmostly conserved

310Cmostly conserved

314Cmostly conserved

319Amostly conserved

321Tmostly conserved

328Tmostly conserved

343Gmostly conserved

344Tmostly conserved

346Amostly conserved

349Amostly conserved

355Tmostly conserved

370Cmostly conserved

379Tmostly conserved

382Tmostly conserved

391Tmostly conserved

394Tmostly conserved

396Gmostly conserved

397Gmostly conserved

398Gmostly conserved

400Tmostly conserved

TCCGCGGTTAAATAATTTCAGTTACTGAATTTTACCAGGCGCTTTATTTATAGTAATAATATCTGCCTTAATCGAGGGGGGGGTGGGTAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anadara broughtoniisame genus10.6%Anadara kagoshimensissame genus14.2%Anadara globosasame genus16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type468 records

Wild obs. + sensor146

Museum / vouchered213

Fossil1

Other108

Range

Area of Occupancy AOO864 km²

Depth

0–200 m sunlit176

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 20 m · max 132.8 m · 176 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 3≤1 km 2≤10 km 1

6 georeferenced · 140 without coordinates

Open the mapobservation + sensor146

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 1≤1 km 16≤10 km 28>10 km 17

62 georeferenced · 151 without coordinates

Open the institutions mapphysical evidence213

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NIMRDlocation not on record	60
Padua universtiy?location not on record	12
MARC, ZSIlocation not on record	11
Philadelphia, US	8
National Marine Biodiversity Institute of Korealocation not on record	7
Natural History Museum Rotterdamlocation not on record	5
Provincia di Livornolocation not on record	5
Ocean University of China Museumlocation not on record	4
Institut Francais pour l'Etude de la Merlocation not on record	3
Denver, US	3
Santa Barbara Museum of Natural Historylocation not on record	3
Laboratoria di biologia marina di Triestelocation not on record	2
Cambridge, US	2
CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Université de Liège Underwater research and oceanographic station (4501)location not on record	1
Natural History Museum of Utahlocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
486location not on record	1
Brussels, BE	1
Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record	1
UKRSCESlocation not on record	1
Chicago, US	1
CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record	1
Paleontological Research Institutionlocation not on record	1

23 institutions · 135 of 213 vouchered records shown · 16 without an institution code

09Environmental DNA10 detections

Where the DNA of Anadara inaequivalvis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)