Anadara globosa

(Reeve, 1844) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Arcida/Arcidae/Anadara

At a glance

Occurrence records25

Data sources7

Biological traits7

DNA specimens22

eDNA detections23

Sources7 archives

Databases and archives Anadara globosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

OBISOcean Biodiversity Information System8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS25 records

Environmental DNA2 datasets · 3 countries23 detections

DNA & barcodingBOLD22 specimens

01Narrative

Anadara globosa is een tweekleppigensoort uit de familie van de Arcidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1844 door Reeve.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length11.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max20 m

Depth min0 m

Vulnerability10

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anadara globosa has left across the world's sequence archives.

At a glance

DNA specimens22

BINs2

Marker genes1

eDNA detections23

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P424 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)1.6%

Haplotypes2

BINs2

Most divergent pair6.1%

Where individuals differ — all 26 variable positions, in barcode order

7Gmostly conserved

16Cmostly conserved

46Gmostly conserved

55Cmostly conserved

85Tmostly conserved

109Amostly conserved

121Gmostly conserved

124Gmostly conserved

136Amostly conserved

139Amostly conserved

154Amostly conserved

175Tmostly conserved

224Gmostly conserved

244Tmostly conserved

250Tmostly conserved

259Gmostly conserved

292Gmostly conserved

298Amostly conserved

299Cmostly conserved

301Tmostly conserved

322Gmostly conserved

361Tmostly conserved

364Gmostly conserved

367Tmostly conserved

385Cmostly conserved

421Amostly conserved

TCCTCGGTTAAATAACTTTAGATATTGGGTTTTACCAGGTGCTTTGTTTATAGTCATTATGTCTGCTCTTATTGAGGGTGGGGTTGGTAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anadara vellicatasame genus14.2%Anadara crebricostatasame genus14.4%Anadara inaequivalvissame genus16.7%Anadara broughtoniisame genus17.4%Tegillarca nodiferasame family17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type25 records

Wild obs. + sensor2

Museum / vouchered23

Range

Area of Occupancy AOO48 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 9 m · max 9 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 2>10 km 4

7 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ocean University of China Museumlocation not on record	8
Philadelphia, US	2
Cambridge, US	1
ARMS-MBONlocation not on record	1
CASlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

6 institutions · 14 of 23 vouchered records shown · 1 without an institution code

09Environmental DNA23 detections

Where the DNA of Anadara globosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys2

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map3 countries0

Research site; semi-industrial; 9.5 - Subtid…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo 13.8–91.0

Air humidity45.7 % 45.7–57.2

Moisture balance-95.2 mm/mo -95.2–-52.7

Vapour deficit827 Pa

Wind speed4.50 m/s 2.90–4.50

Cloud cover24.1 % 24.1–35.3

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)