Anadara broughtonii

(Schrenck, 1867) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Arcida/Arcidae/Anadara

At a glance

Occurrence records550

Data sources11

Biological traits6

DNA specimens3

eDNA detections165

Sources11 archives

Databases and archives Anadara broughtonii's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility328 records↗

OBISOcean Biodiversity Information System222 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI165 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Chemical compositionLOTUS · NPASS30 compounds

Occurrence & distributionGBIF · OBIS550 records

Environmental DNA1 datasets · 2 countries165 detections

DNA & barcodingBOLD3 specimens

01Narrative

Anadara broughtonii is a species of Ark clam. The species was described by Shrenck in 1867. Originally belonging to the genus Scapharca, the genus has merged with Anadara now. Adult blood clams can reach a shell length of 100 mm and are commercially harvested in China, Japan, and Korea as a source of sashimi. To develop both the scientific research and improve the aquaculture of blood clams, a chromosomal-level genome assembly of the S. broughtonii genome has been sequenced and assembled, producing a 884.5-Mb genome.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Life cycle & reproduction1

Max. longevity780 months

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max60 m

Depth min0 m

03Chemical composition30 compounds

Compounds documented for Anadara broughtonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Secoiridoid monoterpenoids17

Cinnamic acids and derivatives $ Phenylethanoids3

Iridoids monoterpenoids $ Secoiridoid monoterpenoids2

Polyamines1

Menthane monoterpenoids1

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,5S,6E,7S,14R,15S,16S,17R)-6-ethylidene-16-(hydroxymethyl)-14,17-dimethyl-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,8,12-trioxatricyclo[13.2.1.05,10]octadec-9-ene-3,11-dione	present	NPASS
(4S,5E,6S)-5-ethylidene-4-[2-[(1S,2R,3S,4S)-3-[[2-[(2S,3E,4S)-3-ethylidene-5-methoxycarbonyl-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4H-pyran-4-yl]acetyl]oxymethyl]-4-[(2S)-1-hydroxypropan-2-yl]-2-methylcyclopentyl]oxy-2-oxoethyl]-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4H-pyran-3-carboxylic acid	present	NPASS
(5R,6S,8S,9R,10S,15S,16E,17S)-16-ethylidene-8-hydroxy-5,9-dimethyl-17-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,12,18-trioxatricyclo[13.4.0.06,10]nonadec-1(19)-ene-2,13-dione	present	NPASS
[(2R,3R,4R,5R,6R)-2-[[(2R,3R,4S)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxymethyl]-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-4-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
[(2R,3R,4R,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2-[[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
Agmatine	present	LOTUS
CLDCOIMYWCHYPI-OCVOHJKQSA-N	present	NPASS
Damsin	present	NPASS
GCVHEYYKXYZLNQ-SHILESBBSA-N	present	NPASS
IVSNJPCWTDNKHQ-UOFHYGTESA-N	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anadara broughtonii has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections165

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P558 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

39Tvariable

123Avariable

149Avariable

TGTTTAAGATTCCACATCCGCTTGAATTTAGCTCAGCCTGGAGGTATTTACAGGGAAATAGGTCAACTTTATAATGTTATTGTAACTAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes3

BIN1

Most divergent pair0.54%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anadara kagoshimensissame genus10.2%Anadara inaequivalvissame genus10.6%Anadara globosasame genus17.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type550 records

Wild obs. + sensor88

Museum / vouchered432

Fossil30

Range

Area of Occupancy AOO452 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 12.1 m · max 15.7 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 22≤1 km 3≤10 km 4

29 georeferenced · 59 without coordinates

Open the mapobservation + sensor88

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 5

8 georeferenced · 424 without coordinates

Open the institutions mapphysical evidence432

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	182
NSMKlocation not on record	28
Philadelphia, US	5
Santa Barbara Museum of Natural Historylocation not on record	5
Natural History Museum of Utahlocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
Washington, US	2
ENHMlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Denver, US	1
CASlocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Stockholm, SE	1
Helsinki, FI	1
Los Angeles, US	1

15 institutions · 237 of 432 vouchered records shown

09Environmental DNA165 detections

Where the DNA of Anadara broughtonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found165

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 165 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 7.40–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 9.60–15.7

Min temp (night)3.10 °C 3.00–3.10

Precipitation13.8 mm/mo 13.8–344

Air humidity45.7 % 45.7–64.9

Moisture balance-95.2 mm/mo -95.2–263

Vapour deficit827 Pa 428–827

Wind speed4.50 m/s 2.90–4.50

Cloud cover24.1 % 24.1–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)