Anacrusis ellensatterleeae

Brown, 2014 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Anacrusis

At a glance

Occurrence records7

Data sources4

Biological traits0

DNA specimens69

eDNA detections65

Sources4 archives

Databases and archives Anacrusis ellensatterleeae's data was compiled from.

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics69 specimens↗

Catalogue of LifeCOLtaxonomy↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 1 countries65 detections

DNA & barcodingBOLD69 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding69 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacrusis ellensatterleeae has left across the world's sequence archives.

At a glance

DNA specimens69

BINs1

Marker genes1

eDNA detections65

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus65 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

91Amostly conserved

433Avariable

619Tvariable

634Cvariable

AACATTATACTTTATTTTCGGAATTTGATCAGGAATAATTGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes9

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacrusis terrimccarthyaesame genus8.8%Anacrusis nephrodessame genus10.5%Coleophora tollamseliellasame order11.8%Lobesia vanillanasame family12.2%Lobesia transtriferasame family12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 records

Museum / vouchered7

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Pennsylvanialocation not on record	5
Washington, US	1
Escuela Agrícola Panamericanalocation not on record	1

3 institutions · 7 of 7 vouchered records shown

09Environmental DNA65 detections

Where the DNA of Anacrusis ellensatterleeae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.9. Subtropical/Trop…1. Forest & Woodland|1.9. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.5–25.7

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.2 °C 26.2–29.6

Min temp (night)21.4 °C 20.6–22.2

Precipitation265 mm/mo 50.6–418

Air humidity68.4 % 63.3–74.7

Moisture balance102 mm/mo -104–288

Vapour deficit939 Pa 743–1,172

Wind speed2.50 m/s 1.20–6.10

Cloud cover31.0 % 15.1–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 63 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)