Anacrusis terrimccarthyae

Brown, 2014 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Anacrusis

At a glance

Occurrence records2

Data sources4

Biological traits0

DNA specimens20

eDNA detections20

Sources4 archives

Databases and archives Anacrusis terrimccarthyae's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Catalogue of LifeCOLtaxonomy↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD20 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacrusis terrimccarthyae has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections20

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

91Cmostly conserved

361Cmostly conserved

466Gvariable

AACATTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacrusis nephrodessame genus9.0%Tortrix celatrixsame family9.0%Decodes helixsame family9.1%Phocoderma betissame order10.2%Agrotis clavissame order10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Institution	Specimens
University of Pennsylvanialocation not on record	1
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Anacrusis terrimccarthyae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 19.2–25.2

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.3 °C 22.4–30.1

Min temp (night)21.0 °C 16.2–21.8

Precipitation218 mm/mo 15.8–494

Air humidity66.9 % 59.3–71.9

Moisture balance80.7 mm/mo -165–374

Vapour deficit986 Pa 645–1,304

Wind speed1.80 m/s 1.00–5.60

Cloud cover31.2 % 13.5–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)