Anacrusis nephrodes

(Walsingham, 1914) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Anacrusis

At a glance

Occurrence records125

Data sources7

Biological traits0

DNA specimens1 009

eDNA detections925

Sources7 archives

Databases and archives Anacrusis nephrodes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI925 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 009 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF125 records

Environmental DNA1 datasets · 1 countries925 detections

DNA & barcodingBOLD1 009 specimens

01Narrative

Anacrusis nephrodes is a species of moth of the family Tortricidae. It is found in Panama.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 009 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacrusis nephrodes has left across the world's sequence archives.

At a glance

DNA specimens1 009

BINs3

Marker genes1

eDNA detections925

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus876 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

86Avariable

92Tmostly conserved

115Tmostly conserved

235Tmostly conserved

316Avariable

631Gvariable

AACATTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCCGAATTAGGAAATCCTAGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes21

BINs3

Most divergent pair10.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacrusis terrimccarthyaesame genus9.0%Cryptophlebia rutilescenssame family9.1%Neosphaleroptera nubilanasame family9.4%Cydia seclusanasame family9.5%Sparganothis tristriatasame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type125 records

Museum / vouchered125

Range

Area of Occupancy AOO144 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 125 records without

Open the institutions mapphysical evidence125

10Collections & institutions

Institution	Specimens
University of Pennsylvanialocation not on record	89
National Biodiversity Institute, Costa Ricalocation not on record	30
Area de Conservacion Guanacastelocation not on record	3
Research Collection of D. H. Janzen & W. Hallwachslocation not on record	2

4 institutions · 124 of 125 vouchered records shown · 1 without an institution code

09Environmental DNA925 detections

Where the DNA of Anacrusis nephrodes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found925

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 925 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.1–25.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 25.6–29.2

Min temp (night)21.7 °C 20.7–22.2

Precipitation288 mm/mo 58.6–468

Air humidity70.8 % 64.9–75.5

Moisture balance164 mm/mo -102–334

Vapour deficit830 Pa 717–1,128

Wind speed1.80 m/s 1.20–4.00

Cloud cover30.6 % 15.1–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 918 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)