Anachloris uncinata

(Guenée) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Anachloris

At a glance

Occurrence records380

Data sources7

Biological traits0

DNA specimens81

eDNA detections59

Sources7 archives

Databases and archives Anachloris uncinata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility380 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI59 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics81 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF380 records

Environmental DNA1 datasets · 1 countries59 detections

DNA & barcodingBOLD81 specimens

01Narrative

Anachloris uncinata, the hook-winged carpet, is a moth of the family Geometridae. It was first described by Achille Guenée in 1863 and is found in the southern half of Australia. The wingspan is 30 mm. The larvae feed on Hibbertia obtusifolia and Hibbertia stricta.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding81 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anachloris uncinata has left across the world's sequence archives.

At a glance

DNA specimens81

BINs6

Marker genes1

eDNA detections59

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus70 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

19Tmostly conserved

40Amostly conserved

43Amostly conserved

46Tmostly conserved

49Amostly conserved

56Tmostly conserved

59Cvariable

79Gmostly conserved

88Amostly conserved

100Amostly conserved

103Tmostly conserved

106Tmostly conserved

118Tmostly conserved

181Gvariable

187Cmostly conserved

202Amostly conserved

217Gvariable

220Avariable

238Tmostly conserved

241Amostly conserved

250Tmostly conserved

259Tmostly conserved

271Tmostly conserved

277Cmostly conserved

313Cvariable

316Amostly conserved

343Gmostly conserved

346Tmostly conserved

347Tmostly conserved

352Tmostly conserved

355Tmostly conserved

361Tvariable

364Amostly conserved

379Tmostly conserved

385Cmostly conserved

388Amostly conserved

394Tmostly conserved

401Tmostly conserved

406Tmostly conserved

418Tmostly conserved

421Tmostly conserved

433Tmostly conserved

469Tmostly conserved

487Tmostly conserved

500Tmostly conserved

508Tmostly conserved

517Amostly conserved

529Tmostly conserved

542Tmostly conserved

544Amostly conserved

547Amostly conserved

553Gmostly conserved

557Tmostly conserved

559Amostly conserved

565Gmostly conserved

586Amostly conserved

589Cmostly conserved

616Cvariable

628Gvariable

634Tvariable

653Cvariable

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTACTAATTCGTGCTGAATTAGGGAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes11

BINs6

Most divergent pair12.3%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anachloris subochrariasame genus7.6%Euphyia unangulatasame family7.6%Anticlea switzerariasame family7.9%Euglyphis mariasame order8.2%Darisodes oritrophasame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type380 records

Wild obs. + sensor270

Museum / vouchered110

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 56≤1 km 75≤10 km 11>10 km 3

145 georeferenced · 125 without coordinates

Open the mapobservation + sensor270

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 26≤1 km 1≤10 km 6

33 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museums Victorialocation not on record	71
Tasmanian Museum & Art Gallerylocation not on record	26
ZSMlocation not on record	5
Australian National Insect Collectionlocation not on record	4
Centre for Biodiversity Genomicslocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

6 institutions · 108 of 110 vouchered records shown · 2 without an institution code

09Environmental DNA59 detections

Where the DNA of Anachloris uncinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found59

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 59 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 16.0–22.7

Seasonal swing summer↔winter12.2 °C

Max temp (day)25.4 °C 20.9–30.2

Min temp (night)14.8 °C 11.2–15.5

Precipitation23.9 mm/mo 10.2–43.4

Air humidity52.7 % 50.0–56.5

Moisture balance-134 mm/mo -179–-46.5

Vapour deficit1,084 Pa 805–1,378

Wind speed3.20 m/s 2.60–3.90

Cloud cover10.8 % 9.60–17.3

CHELSA 1981–2010, ~9 km grid, at location & month of 59 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)