Anachloris subochraria

Doubleday, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Anachloris

At a glance

Occurrence records1 380

Data sources7

Biological traits0

DNA specimens42

eDNA detections37

Sources7 archives

Databases and archives Anachloris subochraria's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 380 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 380 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD42 specimens

01Narrative

Anachloris subochraria (also known as Australian yellow or Willowherb yellow) is a species of moth of the family Geometridae. It is found in New Zealand and the southern half of Australia including Tasmania and from Queensland across to Western Australia. This moth is day flying and can be found in New Zealand on the wing between November and April. A. subochraria was first described by Edward Doubleday in 1843. The wingspan is about 30 mm. The larvae feed on Hibbertia species. In New Zealand the larvae have been observed feeding on the naturalised weed, ragwort (Jacobaea vulgaris).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anachloris subochraria has left across the world's sequence archives.

At a glance

DNA specimens42

BINs2

Marker genes1

eDNA detections37

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

22Amostly conserved

28Amostly conserved

85Tmostly conserved

118Tmostly conserved

145Cmostly conserved

197Tmostly conserved

199Gmostly conserved

238Cmostly conserved

250Tmostly conserved

271Tmostly conserved

298Amostly conserved

316Amostly conserved

349Amostly conserved

364Cmostly conserved

400Cmostly conserved

401Cmostly conserved

466Gvariable

469Amostly conserved

547Amostly conserved

548Cmostly conserved

565Avariable

574Cmostly conserved

577Gvariable

578Tmostly conserved

616Cmostly conserved

619Tmostly conserved

628Gvariable

AACTTTATATTTTATTTTCGGAATTTGAGCTGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGGAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes15

BINs2

Most divergent pair3.2%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anachloris uncinatasame genus7.6%Euphyia unangulatasame family9.0%Darisodes oritrophasame family9.1%Eois angulatasame family9.1%Hydriomena similarissame family9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 380 records

Wild obs. + sensor1 161

Museum / vouchered163

Other56

Range

Area of Occupancy AOO2 732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 516≤1 km 190≤10 km 78>10 km 43

827 georeferenced · 334 without coordinates

Open the mapobservation + sensor1 161

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 8≤1 km 7≤10 km 26

41 georeferenced · 122 without coordinates

Open the institutions mapphysical evidence163

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	121
Auckland, NZ	18
Landcare Research, New Zealand Arthropod Collectionlocation not on record	4
Tasmanian Museum & Art Gallerylocation not on record	4
Australian National Insect Collectionlocation not on record	3
MWLRlocation not on record	2
Australian National Fish Collectionlocation not on record	2
New Zealand Arthropod Collectionlocation not on record	2
New Haven, US	1

9 institutions · 157 of 163 vouchered records shown · 6 without an institution code

09Environmental DNA37 detections

Where the DNA of Anachloris subochraria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 12.4–19.5

Seasonal swing summer↔winter14.5 °C

Max temp (day)18.8 °C 16.0–21.9

Min temp (night)8.70 °C 7.00–14.9

Precipitation63.5 mm/mo 52.2–80.2

Air humidity57.9 % 56.4–60.5

Moisture balance-57.5 mm/mo -82.1–-33.6

Vapour deficit654 Pa 599–902

Wind speed2.90 m/s 2.00–4.30

Cloud cover20.6 % 16.8–37.4

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anachloris subochraria

At a glance

Sources7 archives

At a glance

Record type1 380 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 380 records