Anticlea switzeraria

(Wright, 1916) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Anticlea

At a glance

Occurrence records27

Data sources6

Biological traits0

DNA specimens6

eDNA detections5

Sources6 archives

Databases and archives Anticlea switzeraria's data was compiled from.

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD6 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anticlea switzeraria has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes1

BINs2

Where individuals differ — all 32 variable positions, in barcode order

3Cmostly conserved

4Amostly conserved

5Tmostly conserved

50Tmostly conserved

52Amostly conserved

58Amostly conserved

67Tmostly conserved

91Amostly conserved

190Amostly conserved

214Gmostly conserved

220Tmostly conserved

232Amostly conserved

238Tmostly conserved

271Cmostly conserved

282Tmostly conserved

337Amostly conserved

340Tmostly conserved

343Tmostly conserved

373Amostly conserved

386Tmostly conserved

412Amostly conserved

421Cmostly conserved

469Tmostly conserved

499Tmostly conserved

517Tmostly conserved

553Cmostly conserved

578Cmostly conserved

586Gmostly conserved

616Cmostly conserved

619Amostly conserved

631Amostly conserved

645Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anticlea pectinatasame genus5.4%Eois spnrsame family6.2%Larentia clavariasame family6.7%Colostygia laetariasame family6.7%Colostygia circumvallariasame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type27 records

Wild obs. + sensor1

Museum / vouchered26

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 3>10 km 1

6 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
San Diego, US	6

2 institutions · 26 of 26 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Anticlea switzeraria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 12.4–13.5

Seasonal swing summer↔winter9.50 °C

Max temp (day)17.6 °C 17.5–18.0

Min temp (night)8.10 °C 7.40–8.70

Precipitation58.7 mm/mo 57.9–66.8

Air humidity58.3 % 55.6–60.0

Moisture balance3.70 mm/mo -23.3–7.60

Vapour deficit619 Pa 617–638

Wind speed1.60 m/s 1.50–1.60

Cloud cover36.2 % 32.8–36.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)