Anticlea pectinata

(Rindge, 1967) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Anticlea

At a glance

Occurrence records49

Data sources6

Biological traits0

DNA specimens15

eDNA detections15

Sources6 archives

Databases and archives Anticlea pectinata's data was compiled from.

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF49 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD15 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anticlea pectinata has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

76Amostly conserved

154Cvariable

163Avariable

352Cvariable

568Tvariable

574Gvariable

TTTATATTTTATTTTTGGAATTTGAGCCGGAATAATTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes5

BIN1

Most divergent pair0.92%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anticlea switzerariasame genus5.4%Synemon nothasame order7.0%Glaucina ochrofuscariasame family7.0%Eutomopepla discuneatasame family7.2%Euphyia unangulatasame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type49 records

Wild obs. + sensor15

Museum / vouchered34

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 3≤1 km 2>10 km 10

15 georeferenced

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 2≤10 km 11>10 km 1

14 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
New Haven, US	9
Colorado State Universitylocation not on record	3
East Lansing, US	2

4 institutions · 34 of 34 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Anticlea pectinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.90 °C 3.60–12.9

Seasonal swing summer↔winter19.7 °C

Max temp (day)14.6 °C 9.20–19.2

Min temp (night)3.60 °C -1.80–6.40

Precipitation56.8 mm/mo 37.3–106

Air humidity48.3 % 47.5–49.7

Moisture balance-12.0 mm/mo -86.5–35.9

Vapour deficit592 Pa 401–786

Wind speed4.20 m/s 3.60–4.70

Cloud cover42.2 % 38.0–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)