Amphiporus lactifloreus

(Johnston, 1828) · species

image placeholder — illustration coming later

Animalia/Nemertea/Hoplonemertea/Monostilifera/Amphiporidae/Amphiporus

At a glance

Occurrence records184

Data sources9

Biological traits2

DNA specimens8

eDNA detections10

Sources9 archives

Databases and archives Amphiporus lactifloreus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility130 records↗

OBISOcean Biodiversity Information System54 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS184 records

Environmental DNA2 datasets · 2 countries10 detections

DNA & barcodingBOLD8 specimens

01Narrative

Amphiporus lactifloreus is a species of ribbon worm in the phylum Nemertea. It is found on the lower shore, under stones, in shingle and amongst the fronds of seaweed.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphiporus lactifloreus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections10

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 108 variable positions, in barcode order

2Cvariable

3Tvariable

5Tmostly conserved

6Avariable

7Tmostly conserved

8Avariable

9Tmostly conserved

12Tmostly conserved

15Amostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

21Amostly conserved

22Gmostly conserved

23Tmostly conserved

24Tmostly conserved

26Gmostly conserved

27Amostly conserved

28Tmostly conserved

29Cmostly conserved

30Tmostly conserved

31Gmostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

36Amostly conserved

38Tmostly conserved

39Tmostly conserved

40Gmostly conserved

41Gmostly conserved

42Amostly conserved

43Amostly conserved

45Tmostly conserved

46Gmostly conserved

47Cmostly conserved

48Cmostly conserved

49Tmostly conserved

50Tmostly conserved

51Amostly conserved

52Amostly conserved

53Gmostly conserved

55Cmostly conserved

57Tmostly conserved

58Tmostly conserved

60Amostly conserved

61Amostly conserved

62Tmostly conserved

64Cmostly conserved

65Gmostly conserved

68Cmostly conserved

69Tmostly conserved

70Gmostly conserved

71Amostly conserved

73Cmostly conserved

74Tmostly conserved

76Gmostly conserved

77Gmostly conserved

80Amostly conserved

81Gmostly conserved

82Cmostly conserved

83Cmostly conserved

84Tmostly conserved

86Gmostly conserved

87Gmostly conserved

88Gmostly conserved

89Cmostly conserved

90Cmostly conserved

91Cmostly conserved

93Amostly conserved

94Tmostly conserved

95Tmostly conserved

98Gmostly conserved

99Gmostly conserved

126Amostly conserved

174Amostly conserved

180Cmostly conserved

231Cmostly conserved

264Amostly conserved

267Amostly conserved

282Amostly conserved

363Cmostly conserved

417Cmostly conserved

492Amostly conserved

528Gmostly conserved

537Tmostly conserved

570Tmostly conserved

573Tmostly conserved

582Gmostly conserved

626Gmostly conserved

627Tmostly conserved

631Gmostly conserved

632Amostly conserved

633Tmostly conserved

635Cmostly conserved

637Amostly conserved

640Tmostly conserved

642Gvariable

644Amostly conserved

645Tmostly conserved

646Cmostly conserved

647Amostly conserved

648Gmostly conserved

649Cmostly conserved

650Amostly conserved

652Tmostly conserved

654Amostly conserved

657Tmostly conserved

TCTTTATATTTTTTATTTGGAGTTTGATCTGGGTTAGTTGGAACTGCCTTAAGTCTTTTAATTCGTGCTGAGCTGGGGCAGCCTGGGGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.2%

Haplotypes3

BINs2

Most divergent pair4.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphiporus formidabilissame genus12.5%Amphiporus angulatussame genus12.9%Paranemertes peregrinasame order14.3%Amphiporus imparispinosussame genus14.3%Nemertovema norenburgisame family14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type184 records

Wild obs. + sensor55

Museum / vouchered112

Other17

Range

Area of Occupancy AOO356 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 12.5 m · max 13.5 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 36≤1 km 8≤10 km 2

46 georeferenced · 9 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 6≤1 km 12≤10 km 3

21 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	22
DASSHlocation not on record	12
NHMOlocation not on record	9
Washington, US	8
PNHSlocation not on record	5
Helsinki, FI	2
New Haven, US	1
Cambridge, US	1
Swedish Species Information Centrelocation not on record	1
Marine Biological Association of the UKlocation not on record	1
Natural History Museum, Londonlocation not on record	1
SLU Artdatabankenlocation not on record	1
South Kensington, GB	1

13 institutions · 65 of 112 vouchered records shown · 7 without an institution code

09Environmental DNA10 detections

Where the DNA of Amphiporus lactifloreus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

Underside of rockMud/rocks

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature18.4 °C 17.6–19.9

Conductivity47,322 µS/cm 46,073–48,283

Salinity35.5 PSU 35.4–36.2

Dissolved oxygen7.30 mg/L

Turbidity0.546 NTU 0.25–0.768

Nitrate0.9 µmol/L 0.5–7.80

Depth45.0 m 30.0–100

Pelagic

4 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 9.90–19.2

Seasonal swing summer↔winter7.00 °C

Max temp (day)16.5 °C 11.5–20.4

Min temp (night)13.8 °C 8.20–18.0

Precipitation78.9 mm/mo 64.0–116

Air humidity60.6 % 56.2–63.4

Vapour deficit708 Pa 457–951

Cloud cover30.0 % 11.7–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)