Amphiporus formidabilis

Griffin, 1898 · species

image placeholder — illustration coming later

Animalia/Nemertea/Hoplonemertea/Monostilifera/Amphiporidae/Amphiporus

At a glance

Occurrence records271

Data sources7

Biological traits2

DNA specimens31

eDNA detections1 090

Sources7 archives

Databases and archives Amphiporus formidabilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility152 records↗

OBISOcean Biodiversity Information System119 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 090 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS271 records

Environmental DNA4 datasets · 2 countries1 090 detections

DNA & barcodingBOLD31 specimens

01Narrative

Amphiporus formidabilis is een soort in de taxonomische indeling van de snoerwormen (Nemertea). De huid van de worm is geheel met trilharen bedekt. De snoerworm jaagt op prooien van zijn eigen omvang en vangt deze met behulp van zijn slurf. De worm behoort tot het geslacht Amphiporus en behoort tot de familie Amphiporidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1898 door Griffin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphiporus formidabilis has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes11

eDNA detections1 090

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

7Amostly conserved

24Tmostly conserved

106Tmostly conserved

625Tmostly conserved

626Gmostly conserved

630Gmostly conserved

631Cmostly conserved

640Tmostly conserved

643Gmostly conserved

GTCTTTATATTTTTTATTTGGGGTGTGGTCTGGCTTAGTTGGGACTGCTTTGAGTTTGTTGATTCGTGCTGAGTTAGGTCAGCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphiporus imparispinosussame genus11.4%Paranemertes peregrinasame order12.0%Ototyphlonemertes ernebasame order12.1%Amphiporus lactifloreussame genus12.5%Prostoma graecensesame order12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_023929 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND6CYTBND4LND4ND5COX3ND3COX1ND2COX2ATP8ATP6ND1rrnSrrnL

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type271 records

Wild obs. + sensor22

Museum / vouchered246

Other3

Range

Area of Occupancy AOO196 km²

Depth

0–200 m sunlit102

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 29 m · 102 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 12≤1 km 2≤10 km 2

16 georeferenced · 6 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 2≤10 km 1

3 georeferenced · 243 without coordinates

Open the institutions mapphysical evidence246

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	16
Washington, US	10
Florida Museum of Natural Historylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Cambridge, US	1
Los Angeles, US	1
Edmonton, CA	1

7 institutions · 33 of 246 vouchered records shown · 97 without an institution code

09Environmental DNA1 090 detections

Where the DNA of Amphiporus formidabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 090

Studies independent surveys4

Countries2

Verifiable raw sequence linked1 070

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 090 detections have coordinates

Open the map2 countries0

rock wallarticulated coralline algaerocky intertidalmid intertidal mussell bedMarinelow intertidal crevice

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.40 °C -11.8–11.4

Seasonal swing summer↔winter37.4 °C

Max temp (day)9.60 °C -9.50–15.5

Min temp (night)3.60 °C -14.3–8.80

Precipitation89.4 mm/mo 31.1–116

Air humidity63.5 % 60.8–73.5

Moisture balance30.6 mm/mo

Vapour deficit330 Pa 70.9–521

Wind speed4.20 m/s

Cloud cover51.0 % 43.3–61.0

CHELSA 1981–2010, ~9 km grid, at location & month of 1 087 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)