Prostoma graecense

(Böhmig, 1892) · species

image placeholder — illustration coming later

Animalia/Nemertea/Hoplonemertea/Monostilifera/Prostomatidae/Prostoma

At a glance

Occurrence records173

Data sources7

Biological traits4

DNA specimens13

eDNA detections3

Sources7 archives

Databases and archives Prostoma graecense's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF173 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD13 specimens

01Narrative

Prostoma jenningsi is a species of ribbon worm known only from one site near Croston, Lancashire. It was described in 1971, and is believed to be the county's only endemic species. It grows up to 20 mm long, with 4–6 black eyespots, and has a long eversible proboscis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length0.25 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prostoma graecense has left across the world's sequence archives.

At a glance

DNA specimens13

BINs3

Marker genes1

eDNA detections3

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Where individuals differ — all 120 variable positions, in barcode order

28Amostly conserved

34Avariable

35Tmostly conserved

37Amostly conserved

43Tmostly conserved

52Amostly conserved

55Amostly conserved

59Cvariable

73Gvariable

76Amostly conserved

79Amostly conserved

82Gmostly conserved

85Tmostly conserved

88Gvariable

100Amostly conserved

109Avariable

115Tmostly conserved

121Amostly conserved

130Amostly conserved

133Tmostly conserved

172Tmostly conserved

184Tmostly conserved

190Amostly conserved

193Tmostly conserved

196Gmostly conserved

197Tmostly conserved

199Amostly conserved

211Amostly conserved

217Amostly conserved

220Avariable

229Gmostly conserved

241Avariable

253Gmostly conserved

256Amostly conserved

263Tmostly conserved

265Amostly conserved

266Cmostly conserved

268Tmostly conserved

271Amostly conserved

280Avariable

282Tmostly conserved

283Tmostly conserved

287Tmostly conserved

289Amostly conserved

290Cmostly conserved

292Tmostly conserved

298Gmostly conserved

301Amostly conserved

304Amostly conserved

307Amostly conserved

308Gmostly conserved

313Amostly conserved

316Gmostly conserved

318Tmostly conserved

319Tmostly conserved

328Tmostly conserved

331Amostly conserved

334Tmostly conserved

337Tmostly conserved

346Amostly conserved

349Avariable

359Gmostly conserved

373Amostly conserved

374Avariable

375Gmostly conserved

382Tmostly conserved

415Gvariable

416Gmostly conserved

418Amostly conserved

424Amostly conserved

433Gvariable

436Tmostly conserved

439Cvariable

466Gmostly conserved

469Tmostly conserved

478Gvariable

484Amostly conserved

490Gmostly conserved

493Avariable

511Amostly conserved

517Gmostly conserved

535Amostly conserved

539Cmostly conserved

541Tmostly conserved

553Tmostly conserved

556Gvariable

557Cmostly conserved

564Gmostly conserved

565Gmostly conserved

566Gmostly conserved

567Cmostly conserved

568Tmostly conserved

569Amostly conserved

571Tmostly conserved

572Amostly conserved

573Cmostly conserved

574Tmostly conserved

575Amostly conserved

576Tmostly conserved

577Gmostly conserved

579Tmostly conserved

580Amostly conserved

582Tmostly conserved

583Gvariable

584Amostly conserved

585Cmostly conserved

586Amostly conserved

587Gmostly conserved

588Amostly conserved

589Tmostly conserved

590Cmostly conserved

591Gmostly conserved

594Amostly conserved

598Tmostly conserved

600Amostly conserved

601Tmostly conserved

602Amostly conserved

625Tmostly conserved

649Gvariable

652Tmostly conserved

TTCTTTATATTTTTTATTTGGAGTTTGATCTGGATTAGTTGGTACTGCTTTAAGATTACTAATTCGTGCTGAGTTAGGACAGCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.2%

Haplotypes4

BINs3

Most divergent pair3.5%

EuropeAsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Prosorhochmus claparediisame order11.7%Oerstedia dorsalissame order12.6%Amphiporus formidabilissame order12.8%Gurjanovella littoralissame order12.8%Prosadenoporus floridensissame order13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type173 records

Wild obs. + sensor24

Museum / vouchered148

Other1

Origin

Native10

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 8≤1 km 10≤10 km 2

20 georeferenced · 4 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 48≤1 km 4≤10 km 4

56 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	72
Cambridge, US	7
State University of New York Buffalo State College, Great Lakes Centerlocation not on record	5
486location not on record	2
Buenos Aires, AR	2
Institut Francais pour l'Etude de la Merlocation not on record	2
Edmonton, CA	2
CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Universite de Rennes I Ecobio : Ecosystems biodiversity evolution (1910)location not on record	1
Helsinki, FI	1
Copenhagen, DK	1
CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Ifremer VIGIES (Information Valuation Service for Integrated Management and Monitoring) (1838)location not on record	1

11 institutions · 96 of 148 vouchered records shown · 52 without an institution code

09Environmental DNA3 detections

Where the DNA of Prostoma graecense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Lake Open Water

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 21.3–21.5

Seasonal swing summer↔winter26.6 °C

Max temp (day)23.9 °C 23.8–24.0

Min temp (night)19.9 °C 19.6–20.1

Precipitation88.5 mm/mo 85.9–91.1

Air humidity60.5 % 60.4–60.6

Moisture balance-79.0 mm/mo -81.1–-76.8

Vapour deficit1,006 Pa 1,002–1,009

Wind speed5.70 m/s 5.60–5.70

Cloud cover36.2 % 35.9–36.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)