Amphiporus angulatus

(Müller, 1774) · species

image placeholder — illustration coming later

Animalia/Nemertea/Hoplonemertea/Monostilifera/Amphiporidae/Amphiporus

At a glance

Occurrence records158

Data sources8

Biological traits4

DNA specimens26

eDNA detections944

Sources8 archives

Databases and archives Amphiporus angulatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility123 records↗

OBISOcean Biodiversity Information System35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI944 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS · NPASS4 compounds

Occurrence & distributionGBIF · OBIS158 records

Environmental DNA3 datasets · 1 countries944 detections

DNA & barcodingBOLD26 specimens

01Narrative

Amphiporus angulatus is een soort in de taxonomische indeling van de snoerwormen (Nemertea). De huid van de worm is geheel met trilharen bedekt. De snoerworm jaagt op prooien van zijn eigen omvang en vangt deze met behulp van zijn slurf. De worm behoort tot het geslacht Amphiporus en behoort tot de familie Amphiporidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1774 door Müller.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max150 m

Depth min0 m

03Chemical composition4 compounds

Compounds documented for Amphiporus angulatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Pyridine alkaloids1

Piperidine alkaloids1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
1-(3,4-Dihydro-5-(2R)-2-piperidinyl-1(2H)-pyridinyl)ethanone	present	NPASS
BJPDKJGEOOTNHF-LJISPDSOSA-N	present	NPASS
MGZIREWUQNMGME-VQJWOFKYSA-N	present	NPASS
Nemertelline	present	LOTUS

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphiporus angulatus has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes1

eDNA detections944

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 78% of positions are identical in every specimen.

Where individuals differ — all 144 variable positions, in barcode order

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

13Tmostly conserved

16Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

22Amostly conserved

23Gmostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

28Gmostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

35Cmostly conserved

37Gmostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Tmostly conserved

44Amostly conserved

46Gmostly conserved

47Gmostly conserved

48Cmostly conserved

49Cmostly conserved

50Cmostly conserved

51Tmostly conserved

52Tmostly conserved

53Amostly conserved

54Gmostly conserved

55Cmostly conserved

56Cmostly conserved

58Cmostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

73Gmostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

81Amostly conserved

82Gmostly conserved

83Cmostly conserved

84Cmostly conserved

85Cmostly conserved

87Gmostly conserved

88Gmostly conserved

89Gmostly conserved

90Cmostly conserved

91Tmostly conserved

95Tmostly conserved

96Tmostly conserved

97Amostly conserved

99Gmostly conserved

100Amostly conserved

110Cmostly conserved

112Gmostly conserved

121Gmostly conserved

127Amostly conserved

166Amostly conserved

184Gmostly conserved

193Tmostly conserved

199Tmostly conserved

205Tmostly conserved

206Cmostly conserved

211Amostly conserved

212Cmostly conserved

214Gmostly conserved

217Gmostly conserved

220Cmostly conserved

223Tmostly conserved

247Cmostly conserved

250Cmostly conserved

256Cmostly conserved

265Gmostly conserved

271Gmostly conserved

278Tmostly conserved

280Amostly conserved

289Tmostly conserved

307Tvariable

316Gmostly conserved

319Gmostly conserved

322Cmostly conserved

325Gmostly conserved

328Cmostly conserved

337Amostly conserved

340Cmostly conserved

343Tmostly conserved

364Gmostly conserved

370Cmostly conserved

373Amostly conserved

376Gmostly conserved

382Cmostly conserved

388Gmostly conserved

406Cmostly conserved

409Amostly conserved

418Cmostly conserved

424Cmostly conserved

433Tmostly conserved

439Cmostly conserved

454Tmostly conserved

475Tmostly conserved

478Tmostly conserved

+24 more variable positions not shown

TTCTTTATATTTTTTATTTGGAGTTTGGTCTGGGCTGGTTGGTACGGCCCTTAGCCTCTTAATTCGTGCTGAGTTAGGGCAGCCCGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes4

BINs2

Most divergent pair12.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphiporus lactifloreussame genus12.9%Amphiporus imparispinosussame genus15.2%Amphiporus formidabilissame genus15.2%Paranemertes peregrinasame order15.7%Prosadenoporus floridensissame order16.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type158 records

Wild obs. + sensor33

Museum / vouchered122

Other3

Range

Area of Occupancy AOO312 km²

Depth

0–200 m sunlit27

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 4.5 m · max 363.9 m · 28 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 8≤1 km 11≤10 km 6

25 georeferenced · 8 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤1 km 3≤10 km 6>10 km 5

14 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence122

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	27
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
New Haven, US	9
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	3
Cambridge, US	2
CASlocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
Maurice Lamontagne Institutelocation not on record	1
Edmonton, CA	1

9 institutions · 57 of 122 vouchered records shown · 34 without an institution code

09Environmental DNA944 detections

Where the DNA of Amphiporus angulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found944

Studies independent surveys3

Countries1

Verifiable raw sequence linked922

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 944 detections have coordinates

Open the map1 country0

Intertidal: mud flat with boulders and seawe…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.60 °C -10.8–11.4

Seasonal swing summer↔winter35.6 °C

Max temp (day)9.60 °C -8.50–15.5

Min temp (night)4.10 °C -13.2–8.80

Precipitation89.4 mm/mo 32.4–116

Air humidity61.7 % 60.8–68.3

Moisture balance38.9 mm/mo

Vapour deficit382 Pa 94.2–521

Wind speed4.40 m/s

Cloud cover51.2 % 47.9–61.0

CHELSA 1981–2010, ~9 km grid, at location & month of 939 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)