Ampedus oblessus

(Say, 1833) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records49

Data sources5

Biological traits0

DNA specimens9

eDNA detections6

Sources5 archives

Databases and archives Ampedus oblessus's data was compiled from.

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF49 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD9 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus oblessus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)2.8%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 56 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

5Cmostly conserved

6Tmostly conserved

7Gmostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

16Cmostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

22Cmostly conserved

23Gmostly conserved

24Cmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

38Cmostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

46Amostly conserved

47Tmostly conserved

48Cmostly conserved

49Cmostly conserved

50Cmostly conserved

51Tmostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

55Cmostly conserved

56Cmostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

69Cmostly conserved

70Cmostly conserved

71Gmostly conserved

72Amostly conserved

91Tmostly conserved

92Cmostly conserved

121Cmostly conserved

415Tmostly conserved

532Tmostly conserved

AACTCTGTACTTCATCTTTGGCGCATGAGCAGGAATACTAGGAACATCCCTAAGCCTATTAATTCGCGCCGAATTAGGAAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus behrensisame genus6.4%Ampedus occidentalissame genus6.4%Ampedus apicatussame genus6.7%Ampedus nigroflavussame genus7.0%Ampedus elegantulussame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type49 records

Wild obs. + sensor42

Museum / vouchered7

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 22≤1 km 13≤10 km 1>10 km 2

38 georeferenced · 4 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lexington, US	2
Saint John, CA	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Biodiversity Institute of Ontariolocation not on record	1

4 institutions · 6 of 7 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Ampedus oblessus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 10.7–18.4

Seasonal swing summer↔winter28.8 °C

Max temp (day)20.7 °C 16.9–22.6

Min temp (night)11.5 °C 4.90–15.0

Precipitation89.2 mm/mo 73.3–90.3

Air humidity57.0 % 54.3–59.0

Moisture balance-43.7 mm/mo -49.6–-36.4

Vapour deficit773 Pa 594–865

Wind speed2.70 m/s 2.60–3.60

Cloud cover44.1 % 42.1–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)