Ampedus nigroflavus

(Goeze, 1777) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records1 495

Data sources6

Biological traits0

DNA specimens13

eDNA detections11

Sources6 archives

Databases and archives Ampedus nigroflavus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 495 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 495 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD13 specimens

01Narrative

Ampedus nigroflavus est une espèce de taupins du genre Ampedus que l'on rencontre en Europe. Cette espèce a été décrite par Johann August Ephraim Goeze en 1777.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus nigroflavus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections11

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

91Amostly conserved

456Tmostly conserved

AACTCTGTACTTTATCTTTGGCGCATGGGCAGGTATACTAGGAACATCCCTAAGCCTATTAATTCGTGCCGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus behrensisame genus4.6%Ampedus occidentalissame genus6.1%Ampedus apicatussame genus6.4%Ampedus nigricollissame genus6.4%Ampedus oblessussame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type1 495 records

Wild obs. + sensor1 002

Museum / vouchered422

Cultivated / captive4

Other67

Origin

Native22

Range

Area of Occupancy AOO3 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 559≤1 km 228≤10 km 121>10 km 6

914 georeferenced · 88 without coordinates

Open the mapobservation + sensor1 002

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 179≤1 km 90≤10 km 73>10 km 10

352 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence422

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	166
Trondheim, NO	43
Tallinn, EE	23
Metsähallituslocation not on record	20
MZLUlocation not on record	16
NMOKlocation not on record	12
Helsinki, FI	10
Olocation not on record	10
Tartu, EE	8
Natural History Museum Rotterdamlocation not on record	8
Copenhagen, DK	6
BioFokuslocation not on record	6
Uniwersytet Wrocławskilocation not on record	6
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	5
Geneva, CH	4
ZSMlocation not on record	3
Provincia di Livornolocation not on record	3
Muzeum Górnośląskie w Bytomiulocation not on record	3
NHMOlocation not on record	3
Philadelphia, US	2
Kuopio, FI	2
Salzburg, AT	2
Paro, BT	2
Dhaka, BD	2
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	2
TMPMlocation not on record	1
Norwegian University of Life Sciences (NMBU)location not on record	1
Cornell University Insect Collectionlocation not on record	1
Tilburg, NL	1
Jyväskylä, FI	1
IFR-DNFlocation not on record	1
NTNU-VMlocation not on record	1
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	1
Stockholm, SE	1
neflocation not on record	1

35 institutions · 377 of 422 vouchered records shown · 45 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Ampedus nigroflavus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C 2.50–14.2

Seasonal swing summer↔winter18.2 °C

Max temp (day)13.1 °C 5.20–18.2

Min temp (night)5.50 °C -0.7–9.60

Precipitation63.1 mm/mo 53.3–89.7

Air humidity60.3 % 58.2–65.4

Moisture balance-26.3 mm/mo -39.4–6.80

Vapour deficit490 Pa 330–669

Wind speed3.60 m/s 2.80–4.30

Cloud cover40.7 % 34.5–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ampedus nigroflavus

At a glance

Sources6 archives

At a glance

Record type1 495 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 495 records