Ampedus apicatus

(Say, 1834) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records199

Data sources8

Biological traits0

DNA specimens26

eDNA detections47

Sources8 archives

Databases and archives Ampedus apicatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF199 records

Environmental DNA1 datasets · 2 countries47 detections

DNA & barcodingBOLD26 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

Ampedus apicatus is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1834 door Say.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus apicatus has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections47

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

589Tmostly conserved

AACCCTATACTTTATCTTTGGAGCATGGGCAGGTATGCTAGGAACATCCCTAAGCCTATTAATTCGCGCCGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes3

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus behrensisame genus5.3%Ampedus nigroflavussame genus6.4%Ampedus elegantulussame genus6.4%Ampedus oblessussame genus6.7%Ampedus nigricollissame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Ampedus apicatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 192×GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

2n 202×GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Schneider MC, Carraro BP, Cella DM, Matiello RR, Artoni RF, et al. (2007) Astylus variegatus (Coleoptera, Melyridae): Cytogenetic study of a population exposed to agrochemical products. Genetics and Molecular Biology 30: 640-645. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type199 records

Wild obs. + sensor76

Museum / vouchered123

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 48≤1 km 12≤10 km 3>10 km 4

67 georeferenced · 9 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 21≤1 km 9≤10 km 31

61 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	27
ASUlocation not on record	21
Royal Saskatchewan Museumlocation not on record	13
Espace pour la vielocation not on record	10
University of Guelphlocation not on record	10
University of Alberta Museums (UAM)location not on record	9
Saint John, CA	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Natural History Museum of Utahlocation not on record	3

9 institutions · 107 of 123 vouchered records shown · 16 without an institution code

09Environmental DNA47 detections

Where the DNA of Ampedus apicatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map2 countries0

ForestGrasslandOld field and forest edgeMixed habitatBetula pap., Pop. trem.farm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 12.6–18.4

Seasonal swing summer↔winter28.8 °C

Max temp (day)20.2 °C 15.5–23.6

Min temp (night)9.70 °C 5.50–14.2

Precipitation81.0 mm/mo 53.6–106

Air humidity56.5 % 51.9–60.2

Moisture balance-48.8 mm/mo -73.3–-19.5

Vapour deficit721 Pa 587–903

Wind speed2.70 m/s 1.70–4.20

Cloud cover42.4 % 40.5–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)