Ampedus melsheimeri

(Leng, 1918) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records31

Data sources8

Biological traits0

DNA specimens18

eDNA detections17

Sources8 archives

Databases and archives Ampedus melsheimeri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD18 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

Ampedus melsheimeri is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1918 door Leng.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus melsheimeri has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P631 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Where individuals differ — all 130 variable positions, in barcode order

1Cmostly conserved

2Amostly conserved

3Cmostly conserved

4Cmostly conserved

5Cmostly conserved

6Tmostly conserved

7Tmostly conserved

9Amostly conserved

10Cmostly conserved

11Tmostly conserved

13Tmostly conserved

14Amostly conserved

16Cmostly conserved

17Tmostly conserved

18Tmostly conserved

19Cmostly conserved

21Gmostly conserved

22Tmostly conserved

23Gmostly conserved

24Cmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

37Amostly conserved

38Cmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

47Tmostly conserved

48Cmostly conserved

49Cmostly conserved

50Cmostly conserved

51Tmostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

55Amostly conserved

58Tmostly conserved

59Cmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Cmostly conserved

65Cmostly conserved

66Gmostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

79Amostly conserved

85Cmostly conserved

88Amostly conserved

92Cmostly conserved

97Cmostly conserved

103Cmostly conserved

115Tmostly conserved

118Tmostly conserved

127Tmostly conserved

136Cmostly conserved

157Tmostly conserved

166Amostly conserved

181Gvariable

193Cmostly conserved

196Amostly conserved

197Cmostly conserved

202Tmostly conserved

206Tmostly conserved

208Gmostly conserved

211Amostly conserved

214Amostly conserved

217Amostly conserved

232Amostly conserved

238Tmostly conserved

244Amostly conserved

247Cmostly conserved

256Amostly conserved

263Tmostly conserved

265Amostly conserved

266Cmostly conserved

268Tvariable

277Amostly conserved

278Cmostly conserved

283Amostly conserved

286Tmostly conserved

287Tmostly conserved

304Cmostly conserved

313Tmostly conserved

316Amostly conserved

347Cmostly conserved

349Cmostly conserved

358Tmostly conserved

367Cmostly conserved

382Tmostly conserved

397Tmostly conserved

400Tmostly conserved

418Tmostly conserved

421Tmostly conserved

427Tmostly conserved

433Amostly conserved

436Cmostly conserved

442Cmostly conserved

460Cmostly conserved

463Tmostly conserved

478Amostly conserved

482Amostly conserved

490Cmostly conserved

493Amostly conserved

499Tmostly conserved

500Tmostly conserved

505Tmostly conserved

518Gmostly conserved

520Tmostly conserved

529Tmostly conserved

+10 more variable positions not shown

CACCCTTTACTTTATCTTCGGTGCATGAGCAGGAATACTAGGCACCTCCCTAAGACTTCTAATCCGTGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.0%

Haplotypes3

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus melanotoidessame genus9.7%Brachygonus megerleisame family9.8%Ampedus fuscatussame genus10.0%Ampedus rhodopussame genus11.5%Ampedus mixtussame genus12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Ampedus melsheimeri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 192×GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

2n 202×GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Schneider MC, Carraro BP, Cella DM, Matiello RR, Artoni RF, et al. (2007) Astylus variegatus (Coleoptera, Melyridae): Cytogenetic study of a population exposed to agrochemical products. Genetics and Molecular Biology 30: 640-645. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type31 records

Wild obs. + sensor5

Museum / vouchered26

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1≤1 km 3>10 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	9
University of Central Floridalocation not on record	3
Espace pour la vielocation not on record	2
Saint John, CA	1
University of Tennessee at Chattanoogalocation not on record	1
Cambridge, US	1
Philadelphia, US	1

7 institutions · 18 of 26 vouchered records shown · 5 without an institution code

09Environmental DNA17 detections

Where the DNA of Ampedus melsheimeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

Forestforest canopy

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 10.7–20.4

Seasonal swing summer↔winter28.8 °C

Max temp (day)22.6 °C 14.6–24.2

Min temp (night)15.0 °C 6.90–17.4

Precipitation93.0 mm/mo 82.8–122

Air humidity59.8 % 58.6–61.1

Moisture balance-38.2 mm/mo -66.7–18.1

Vapour deficit865 Pa 537–954

Wind speed2.70 m/s 2.50–2.90

Cloud cover43.2 % 42.1–56.5

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)