Ampedus fuscatus

(Melsheimer, 1845) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records145

Data sources6

Biological traits0

DNA specimens19

eDNA detections16

Sources6 archives

Databases and archives Ampedus fuscatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility145 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF145 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD19 specimens

01Narrative

Ampedus fuscatus is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1846 door Melsheimer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus fuscatus has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

28Amostly conserved

49Cmostly conserved

50Tmostly conserved

59Cmostly conserved

79Amostly conserved

82Cmostly conserved

88Amostly conserved

133Amostly conserved

196Gmostly conserved

197Cmostly conserved

214Amostly conserved

220Tmostly conserved

235Cmostly conserved

262Amostly conserved

268Tmostly conserved

271Cmostly conserved

289Gmostly conserved

313Tmostly conserved

316Amostly conserved

322Amostly conserved

349Tmostly conserved

355Cmostly conserved

367Cmostly conserved

394Tmostly conserved

407Tmostly conserved

415Gmostly conserved

430Amostly conserved

433Amostly conserved

436Tmostly conserved

511Amostly conserved

517Amostly conserved

523Cvariable

526Cmostly conserved

535Tmostly conserved

536Cmostly conserved

550Amostly conserved

556Cvariable

562Cmostly conserved

607Gmostly conserved

619Tmostly conserved

622Tmostly conserved

631Amostly conserved

634Tmostly conserved

CACTCTTTACTTCATTTTTGGTGCATGAGCAGGAATACTAGGCACCTCCTTAAGACTTCTAATCCGTGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes10

BINs2

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus melsheimerisame genus10.0%Brachygonus megerleisame family11.2%Ampedus melanotoidessame genus11.4%Ampedus nigerrimussame genus11.6%Ampedus rubricussame genus11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type145 records

Wild obs. + sensor4

Museum / vouchered141

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 141 records without

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	113
Cambridge, US	16
University of Guelphlocation not on record	8
East Lansing, US	2
Philadelphia, US	1

5 institutions · 140 of 141 vouchered records shown · 1 without an institution code

09Environmental DNA16 detections

Where the DNA of Ampedus fuscatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate ForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 18.0–24.9

Seasonal swing summer↔winter24.1 °C

Max temp (day)26.6 °C 22.3–30.2

Min temp (night)17.7 °C 13.4–21.2

Precipitation104 mm/mo 88.5–128

Air humidity58.2 % 56.8–60.0

Moisture balance-41.9 mm/mo -89.5–0.2

Vapour deficit1,101 Pa 849–1,254

Wind speed2.60 m/s 2.20–5.70

Cloud cover35.6 % 28.0–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)