Ampedus nigerrimus

(Lacordaire, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records3 726

Data sources6

Biological traits2

DNA specimens65

eDNA detections56

Sources6 archives

Databases and archives Ampedus nigerrimus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 726 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI56 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics65 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 726 records

Environmental DNA1 datasets · 4 countries56 detections

DNA & barcodingBOLD65 specimens

01Narrative

Ampedus nigerrimus is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1835 door Lacordaire.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)omnivore

05DNA & barcoding65 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus nigerrimus has left across the world's sequence archives.

At a glance

DNA specimens65

BINs1

Marker genes3

eDNA detections56

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

263Cmostly conserved

275Tmostly conserved

623Gvariable

CTCTATACTTCATCTTTGGTGCATGAGCAGGAATACTAGGAACATCCCTAAGCCTCTTAATCCGTGCCGAATTAGGAAACCCCGGATCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes5

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus hypogastricussame genus7.8%Ampedus corsicussame genus8.0%Ampedus rubricollissame genus8.2%Ampedus behrensisame genus8.5%Ampedus rufipennissame genus8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type3 726 records

Wild obs. + sensor2 249

Museum / vouchered357

Cultivated / captive2

Fossil3

Other1 115

Origin

Native118

Range

Area of Occupancy AOO3 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 185≤1 km 47≤10 km 1 409>10 km 36

1 677 georeferenced · 572 without coordinates

Open the mapobservation + sensor2 249

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 10≤1 km 28≤10 km 292>10 km 3

333 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence357

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	43
MZLUlocation not on record	19
Zürich, CH	12
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	11
Geneva, CH	10
Salzburg, AT	10
Provincia di Livornolocation not on record	8
Bern, CH	7
Copenhagen, DK	7
Museum zu Allerheiligen Schaffhausenlocation not on record	6
Paro, BT	6
Museo civico Brancaleoni di Piobbicolocation not on record	5
Natural History Museum Rotterdamlocation not on record	5
ZSMlocation not on record	4
Tilburg, NL	4
Muzeum Górnośląskie w Bytomiulocation not on record	4
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	2
Naturmuseum St. Gallenlocation not on record	2
Dhaka, BD	2
IFR-DNFlocation not on record	1
Helsinki, FI	1
LSMlocation not on record	1
Office National des Forets, Laboratoire National d'Entomologie Forestierelocation not on record	1
Research Collection of Julien Delnattelocation not on record	1

24 institutions · 172 of 357 vouchered records shown · 185 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA56 detections

Where the DNA of Ampedus nigerrimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found56

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 56 detections have coordinates

Open the map4 countries0

Hetraie-chenaieSuberaie-pinedeOakBeech

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.80 °C 3.70–15.5

Seasonal swing summer↔winter16.0 °C

Max temp (day)6.60 °C 6.40–19.4

Min temp (night)1.10 °C 1.00–10.7

Precipitation74.7 mm/mo 57.7–90.6

Air humidity67.8 % 58.6–67.8

Moisture balance54.4 mm/mo -40.0–54.4

Vapour deficit260 Pa 251–708

Wind speed3.00 m/s 2.90–3.70

Cloud cover49.2 % 37.8–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 55 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ampedus nigerrimus

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type3 726 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 726 records