Ampedus rufipennis

(Stephens, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records1 817

Data sources6

Biological traits2

DNA specimens43

eDNA detections38

Sources6 archives

Databases and archives Ampedus rufipennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 817 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 817 records

Environmental DNA1 datasets · 4 countries38 detections

DNA & barcodingBOLD43 specimens

01Narrative

Ampedus rufipennis est une espèce de taupins du genre Ampedus. Cette espèce a été décrite par Stephens en 1830.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)omnivore

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus rufipennis has left across the world's sequence archives.

At a glance

DNA specimens43

BINs2

Marker genes4

eDNA detections38

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

16Cmostly conserved

46Amostly conserved

88Avariable

97Cmostly conserved

211Avariable

235Cvariable

244Avariable

316Amostly conserved

517Avariable

AACTTTGTACTTTATCTTTGGCGCATGAGCCGGTATACTAGGTACATCCCTAAGCCTACTAATTCGCGCCGAACTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.99%

Haplotypes5

BINs2

Most divergent pair9.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus corsicussame genus6.0%Ampedus nigricollissame genus7.3%Ampedus cinnabarinussame genus7.8%Ampedus behrensisame genus7.8%Ampedus sanguineussame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type1 817 records

Wild obs. + sensor1 203

Museum / vouchered274

Cultivated / captive5

Other335

Origin

Native40

Range

Area of Occupancy AOO2 700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 268≤1 km 100≤10 km 526>10 km 5

899 georeferenced · 304 without coordinates

Open the mapobservation + sensor1 203

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 33≤1 km 55≤10 km 138>10 km 2

228 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence274

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	59
MZLUlocation not on record	17
Geneva, CH	13
Paris, FR	12
ZSMlocation not on record	11
Provincia di Livornolocation not on record	8
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	8
Copenhagen, DK	7
Bern, CH	6
Fribourg, CH	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
Research Collection of Julien Delnattelocation not on record	2
Frauenfeld, CH	2
Natural History Museum Rotterdamlocation not on record	2
SGAV-and-NHMDlocation not on record	1
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	1
South Kensington, GB	1

17 institutions · 154 of 274 vouchered records shown · 119 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA38 detections

Where the DNA of Ampedus rufipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map4 countries0

ChenaieBeechPinedeHetraie-chenaieForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 4.40–18.6

Seasonal swing summer↔winter16.4 °C

Max temp (day)19.3 °C 8.50–23.1

Min temp (night)11.1 °C 1.20–16.1

Precipitation73.1 mm/mo 33.9–102

Air humidity60.3 % 54.2–65.0

Moisture balance-13.3 mm/mo -119–45.7

Vapour deficit711 Pa 335–981

Wind speed3.20 m/s 1.50–4.10

Cloud cover40.7 % 34.5–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ampedus rufipennis

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type1 817 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 817 records