Ampedus mixtus

(Herbst, 1806) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records89

Data sources6

Biological traits0

DNA specimens17

eDNA detections1

Sources6 archives

Databases and archives Ampedus mixtus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF89 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD17 specimens

01Narrative

Ampedus mixtus is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1806 door Herbst.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus mixtus has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

4Tmostly conserved

58Cvariable

205Avariable

262Gmostly conserved

271Cvariable

292Amostly conserved

304Tvariable

325Amostly conserved

346Cmostly conserved

391Tvariable

406Cvariable

499Cvariable

514Avariable

542Cvariable

547Amostly conserved

553Amostly conserved

577Amostly conserved

583Ahighly variable

634Cvariable

637Avariable

AACTCTGTACTTCATTTTTGGCGCATGAGCAGGAATACTAGGAACATCCTTAAGCCTCTTAATCCGAGCCGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus rubricollissame genus8.4%Ampedus hypogastricussame genus8.5%Ampedus elegantulussame genus8.7%Ampedus nigerrimussame genus8.9%Ampedus corsicussame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type89 records

Wild obs. + sensor36

Museum / vouchered53

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 14≤1 km 12≤10 km 1

27 georeferenced · 9 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 3≤10 km 22>10 km 1

26 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Espace pour la vielocation not on record	23
University of Guelphlocation not on record	11
Royal Saskatchewan Museumlocation not on record	5
Saint John, CA	4
Edmonton, CA	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Philadelphia, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

8 institutions · 49 of 53 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Ampedus mixtus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)