Amorbia concavana

(Zeller, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Amorbia

At a glance

Occurrence records108

Data sources8

Biological traits0

DNA specimens110

eDNA detections108

Sources8 archives

Databases and archives Amorbia concavana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility108 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI108 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics110 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF108 records

Environmental DNA1 datasets · 4 countries108 detections

DNA & barcodingBOLD110 specimens

01Narrative

Amorbia concavana is a species of moth of the family Tortricidae. It is found from Panama to Mexico and on Cuba, where it is found at altitudes between 50 and 300 meters. It has recently found in the United States in southern Florida.First U.S. records of Amorbia concavana (Zeller) (Lepidoptera: Tortricidae) The length of the forewings is 7.5–8.6 mm. The ground color of the forewings is pale yellow with brownish marks in the median and postmedian area near the costa. The hindwing dorsal scaling is beige with a darker apex. Adults are on wing during both the dry and rainy seasons. The larvae are polyphagous and have been reported feeding on Inga vera, Phaseolus species, Mimosa pigra and Hammelia species. 2007 Phylogenetic relationships, systematics, and biology of the species of Amorbia Clemens (Lepidoptera: Tortricidae: Sparganothini).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding110 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amorbia concavana has left across the world's sequence archives.

At a glance

DNA specimens110

BINs3

Marker genes1

eDNA detections108

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus109 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

112Tmostly conserved

142Cmostly conserved

160Amostly conserved

412Amostly conserved

463Tmostly conserved

484Cmostly conserved

493Amostly conserved

553Tmostly conserved

622Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAATTGGAACATCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes21

BINs3

Most divergent pair10.9%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amorbia rectangularissame genus3.5%Amorbia nuptanasame genus6.8%Amorbia osmotrissame genus7.4%Acleris rufanasame family8.8%Acleris lipsianasame family9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type108 records

Wild obs. + sensor44

Museum / vouchered64

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 22≤1 km 10≤10 km 1>10 km 4

37 georeferenced · 7 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 64 records without

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	32
Australian National Insect Collectionlocation not on record	12
National Biodiversity Institute, Costa Ricalocation not on record	11
University of Pennsylvanialocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Cornell University Insect Collectionlocation not on record	1

6 institutions · 58 of 64 vouchered records shown · 6 without an institution code

09Environmental DNA108 detections

Where the DNA of Amorbia concavana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found108

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 108 detections have coordinates

Open the map4 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 23.1–26.4

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.7 °C 26.0–30.0

Min temp (night)22.2 °C 20.4–23.3

Precipitation198 mm/mo 17.5–412

Air humidity65.6 % 58.9–73.3

Moisture balance70.2 mm/mo -135–362

Vapour deficit1,002 Pa 756–1,358

Wind speed2.80 m/s 1.10–5.70

Cloud cover31.3 % 15.3–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 102 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)