Amorbia rectangularis

Meyrick, 1931 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Amorbia

At a glance

Occurrence records43

Data sources8

Biological traits0

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Amorbia rectangularis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF43 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Amorbia rectangularis is a species of moth of the family Tortricidae. It is found from southern Brazil to Guatemala, where it is found at altitudes between 50 and 1,670 meters. The length of the forewings is 6.5–8 mm for males and 9.5–12 mm for females. The ground colour of the forewings is pale yellow with brownish marks in the median and postmedian area near the costa. The hindwings have a dark apical area, bordering a translucent patch. There seem to be multiple generations per year. 2007 Phylogenetic relationships, systematics, and biology of the species of Amorbia Clemens (Lepidoptera: Tortricidae: Sparganothini).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amorbia rectangularis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

101Gmostly conserved

115Cvariable

181Gmostly conserved

214Gmostly conserved

271Gmostly conserved

284Tmostly conserved

340Cmostly conserved

364Amostly conserved

406Tmostly conserved

418Tmostly conserved

448Cmostly conserved

460Tmostly conserved

604Cmostly conserved

622Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAATTGGAACATCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes3

BINs2

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amorbia concavanasame genus3.5%Amorbia osmotrissame genus7.6%Amorbia nuptanasame genus7.6%Amorbia humerosanasame genus8.2%Amorbia cacaosame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor12

Museum / vouchered31

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 4≤1 km 3>10 km 2

9 georeferenced · 3 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 31 records without

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	30
Cornell University Insect Collectionlocation not on record	1

2 institutions · 31 of 31 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Amorbia rectangularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 17.8–18.3

Seasonal swing summer↔winter2.40 °C

Max temp (day)21.9 °C 21.9–22.6

Min temp (night)14.6 °C 14.6–14.9

Precipitation231 mm/mo 203–231

Air humidity71.2 % 70.5–71.2

Moisture balance118 mm/mo 73.5–118

Vapour deficit582 Pa 582–619

Wind speed2.30 m/s 2.20–2.30

Cloud cover15.0 % 13.9–15.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)