Amerila bubo

Walker, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Amerila

At a glance

Occurrence records131

Data sources7

Biological traits0

DNA specimens11

eDNA detections2

Sources7 archives

Databases and archives Amerila bubo's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility131 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF131 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD11 specimens

01Narrative

Amerila bubo is a moth of the subfamily Arctiinae. It was described by Francis Walker in 1855. It is found in Angola, the Democratic Republic of the Congo, Ethiopia, Kenya, Malawi, Namibia, Rwanda, South Africa, Tanzania, Uganda, Zambia and Zimbabwe. The larvae feed on Erythroxylum coca, Bridelia, Erythrina, Ficus congensis, Musa sapientum, Coffea and Solanum species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amerila bubo has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

eDNA detections2

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

2Tmostly conserved

71Cmostly conserved

130Gmostly conserved

214Gmostly conserved

268Tmostly conserved

382Cmostly conserved

388Tmostly conserved

397Cvariable

433Tmostly conserved

466Gmostly conserved

523Cmostly conserved

547Gmostly conserved

593Cmostly conserved

599Amostly conserved

601Cmostly conserved

613Cmostly conserved

634Amostly conserved

ATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCTGAACTAGGAAATCCAGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes6

BINs2

Most divergent pair2.4%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amerila luteibarbasame genus5.0%Amerila roseomarginatasame genus5.0%Amerila lupiasame genus5.1%Amerila phaedrasame genus5.2%Amerila fenniasame genus5.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type131 records

Wild obs. + sensor122

Museum / vouchered9

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 70≤1 km 12≤10 km 8>10 km 1

91 georeferenced · 31 without coordinates

Open the mapobservation + sensor122

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 3

4 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	4
ZSMlocation not on record	2

2 institutions · 6 of 9 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Amerila bubo was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)