Amerila phaedra

Weymer, 1892 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Amerila

At a glance

Occurrence records12

Data sources7

Biological traits0

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Amerila phaedra's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF12 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Amerila phaedra is a moth of the subfamily Arctiinae. It was described by Weymer in 1892. It is found in Kenya, Mozambique, Tanzania and Zimbabwe.Afro Moths

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amerila phaedra has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

4Tmostly conserved

331Tmostly conserved

337Tmostly conserved

523Amostly conserved

ACTTTATTTTATTTTTGGTATTTGAGCTGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCCGAATTAGGTAATCCAGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes3

BIN1

Most divergent pair0.31%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amerila leucopterasame genus2.6%Amerila luteibarbasame genus2.8%Amerila affinissame genus3.1%Amerila nigroapicalissame genus3.4%Amerila lupiasame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type12 records

Wild obs. + sensor12

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 4≤1 km 4≤10 km 2

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA6 detections

Where the DNA of Amerila phaedra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 22.7–25.6

Seasonal swing summer↔winter6.80 °C

Max temp (day)26.8 °C 26.5–30.8

Min temp (night)19.8 °C 18.6–21.8

Precipitation68.2 mm/mo 48.1–116

Air humidity60.3 % 54.9–63.5

Moisture balance-56.6 mm/mo -107–-22.9

Vapour deficit1,099 Pa 1,076–1,492

Wind speed2.40 m/s 2.30–3.90

Cloud cover29.9 % 27.6–35.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)