Amerila luteibarba

Hampson, 1901 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Amerila

At a glance

Occurrence records25

Data sources7

Biological traits0

DNA specimens65

eDNA detections79

Sources7 archives

Databases and archives Amerila luteibarba's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics65 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF25 records

Environmental DNA1 datasets · 13 countries79 detections

DNA & barcodingBOLD65 specimens

01Narrative

Amerila luteibarba is a species of moth of the subfamily Arctiinae. It was described by George Hampson in 1901. It is found in Angola, Benin, Cameroon, the Democratic Republic of the Congo, Gabon, Ghana, Ivory Coast, Kenya, Liberia, Nigeria, Rwanda, Sierra Leone, Tanzania, Togo and Uganda.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding65 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amerila luteibarba has left across the world's sequence archives.

At a glance

DNA specimens65

BINs2

Marker genes1

eDNA detections79

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus64 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

13Tmostly conserved

46Avariable

154Tmostly conserved

271Tmostly conserved

313Tmostly conserved

337Tmostly conserved

487Cmostly conserved

520Amostly conserved

532Tmostly conserved

619Cmostly conserved

637Tmostly conserved

646Cmostly conserved

AACACTTTATTTTATTTTTGGTATTTGAGCTGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes16

BINs2

Most divergent pair2.1%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amerila phaedrasame genus2.8%Amerila lupiasame genus3.1%Amerila nigroapicalissame genus3.2%Amerila leucopterasame genus3.7%Amerila roseomarsinatasame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type25 records

Museum / vouchered25

Range

Area of Occupancy AOO40 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the institutions mapphysical evidence25

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
African Natural History Research Trustlocation not on record	1
Tallinn, EE	1

2 institutions · 2 of 25 vouchered records shown · 23 without an institution code

09Environmental DNA79 detections

Where the DNA of Amerila luteibarba was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found79

Studies independent surveys1

Countries13

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 79 detections have coordinates

Open the map13 countries0

Forest / savannah patchworkPrimary/seconday forestPrimary/ secondary forestTropical rainforestPrimary/secondary forestRainforest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 22.3–26.1

Seasonal swing summer↔winter2.90 °C

Max temp (day)28.1 °C 27.1–30.7

Min temp (night)20.7 °C 17.4–22.7

Precipitation169 mm/mo 75.0–257

Air humidity65.9 % 61.3–69.9

Moisture balance39.0 mm/mo -49.3–136

Vapour deficit974 Pa 897–1,189

Wind speed1.10 m/s 0.8–2.50

Cloud cover37.5 % 25.1–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 76 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)