Amegilla garrula

(Rossi, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Amegilla

At a glance

Occurrence records1 380

Data sources6

Biological traits1

DNA specimens11

eDNA detections0

Sources6 archives

Databases and archives Amegilla garrula's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 380 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 380 records

DNA & barcodingBOLD11 specimens

01Narrative

Amegilla garrula, eine Pelzbiene, ist eine Biene aus der Familie der Apidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)4.28 mm

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amegilla garrula has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

38Cmostly conserved

74Cmostly conserved

85Gvariable

349Amostly conserved

517Amostly conserved

547Cmostly conserved

TATAATTTATTTTTTATTTGCTATTTGAGCAGGAATGCTTGGGACTTCAATAAGAATGATTATTCGAATGGAGCTGAGTACACCGGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora femoratasame family15.9%Ceratina saundersisame family16.2%Anthophora praecoxsame family16.6%Anthophora abruptasame family16.6%Amegilla niveatasame genus16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 380 records

Wild obs. + sensor1 000

Museum / vouchered362

Other18

Origin

Native56

Range

Area of Occupancy AOO2 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 555≤1 km 102≤10 km 118>10 km 36

811 georeferenced · 189 without coordinates

Open the mapobservation + sensor1 000

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 19≤1 km 34≤10 km 290>10 km 5

348 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence362

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	136
Wuzhou, CN	110
University of Monslocation not on record	16
Geneva, CH	10
Plant Protection and Apiculture Section, Department of Agriculture, Ministry of Agriculture, Rural Development and the Environment (Cyprus)location not on record	8
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	6
NNMLlocation not on record	4
PRUNlocation not on record	4
Bern, CH	4
Musee d'Histoire Naturallelocation not on record	4
Philadelphia, US	4
Beltsville, US	3
	3
Cambridge, US	2
Provincia di Livornolocation not on record	2
Museum zu Allerheiligen Schaffhausenlocation not on record	2
PRAZlocation not on record	2
Research Collection of Christophe Prazlocation not on record	1
UMUlocation not on record	1

19 institutions · 322 of 362 vouchered records shown · 40 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amegilla garrula

At a glance

Sources6 archives

Size & morphology1

At a glance

Record type1 380 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Record type1 380 records