Amblyomma oblongoguttatum

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records40

Data sources6

Biological traits0

DNA specimens12

eDNA detections12

Sources6 archives

Databases and archives Amblyomma oblongoguttatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF40 records

Environmental DNA1 datasets · 3 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Amblyomma oblongoguttatum (лат.) — вид клещей рода Amblyomma из семейства Ixodidae. Южная Америка: Мексика, Белиз, Гватемала, Никарагуа, Коста-Рика, Панама, Колумбия, Венесуэла, Гайана, Французская Гвиана, Суринам, Боливия, Перу и Бразилия. Обитатель тропических лесов. Взрослые стадии развития паразитируют на различных видах диких млекопитающих, от тапира и оленей до агути и пака. В Панаме клещей обычно встречают на домашнем скоте и собаках. В отличие от Amblyomma cajennense, эти клещи, видимо, предпочитают девственные биотопы в пределах своего ареала. Это обычный, а в некоторых странах обильный вид. Взрослые и нимфы могут прикрепляться к человеку. Вид был впервые описан в 1844 году немецким энтомологом и арахнологом Карлом Людвигом Кохом. Переносчики риккетсий Rickettsia bellii.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma oblongoguttatum has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections12

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

1Avariable

22Amostly conserved

103Cmostly conserved

109Avariable

111Tmostly conserved

178Cvariable

181Amostly conserved

313Amostly conserved

322Gmostly conserved

328Gmostly conserved

331Amostly conserved

337Cmostly conserved

343Cmostly conserved

373Tmostly conserved

382Gmostly conserved

412Amostly conserved

436Tmostly conserved

448Tmostly conserved

466Gmostly conserved

494Amostly conserved

535Cmostly conserved

544Gmostly conserved

547Amostly conserved

565Gmostly conserved

574Tmostly conserved

583Amostly conserved

624Gmostly conserved

634Tmostly conserved

641Tvariable

AACAATATATTTAATTTTTGGAAGATGAGCAGGAATAACAGGCTTATCAATAAGAATTTTAATTCGAATAGAATTAGGTCAACCTGGCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes7

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma tapirellumsame genus14.3%Amblyomma tigrinumsame genus14.4%Amblyomma pacaesame genus14.7%Amblyomma naponensesame genus15.0%Amblyomma pecariumsame genus15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type40 records

Wild obs. + sensor13

Museum / vouchered27

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 3≤1 km 3>10 km 4

10 georeferenced · 3 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provo, US	2
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
National Biodiversity Institute, Costa Ricalocation not on record	1

4 institutions · 5 of 27 vouchered records shown · 22 without an institution code

09Environmental DNA12 detections

Where the DNA of Amblyomma oblongoguttatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map3 countries0

tropical lowland moist forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.7–26.0

Seasonal swing summer↔winter1.00 °C

Max temp (day)28.8 °C 28.6–29.9

Min temp (night)23.6 °C 22.3–23.7

Precipitation311 mm/mo 206–311

Air humidity71.5 % 65.7–71.5

Moisture balance182 mm/mo 70.8–182

Vapour deficit954 Pa 954–1,133

Wind speed1.80 m/s 1.20–2.70

Cloud cover43.1 % 29.1–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)