Amara hyperborea

Dejean, 1831 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records691

Data sources7

Biological traits0

DNA specimens72

eDNA detections64

Sources7 archives

Databases and archives Amara hyperborea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility691 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI64 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF691 records

Environmental DNA1 datasets · 3 countries64 detections

DNA & barcodingBOLD72 specimens

01Narrative

Amara hyperborea is a species of seed-eating ground beetle in the subfamily Harpalinae. It is found in northeastern China, southern Mongolia, as well as Finland, Canada and the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara hyperborea has left across the world's sequence archives.

At a glance

DNA specimens72

BINs2

Marker genes1

eDNA detections64

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus62 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

70Tmostly conserved

82Cmostly conserved

169Amostly conserved

346Tmostly conserved

347Tmostly conserved

400Cmostly conserved

478Gmostly conserved

616Tvariable

622Gmostly conserved

AACATTATATTTTATTTTTGGTGCTTGATCAGGAATAGTAGGAACTTCATTAAGTATATTAATTCGAGCTGAATTAGGAAACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes6

BINs2

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara convexiusculasame genus6.5%Amara torridasame genus6.9%Amara alpinasame genus7.0%Amara lacustrissame genus7.0%Amara carinatasame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type691 records

Wild obs. + sensor5

Museum / vouchered686

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 2≤10 km 2

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 275≤1 km 29≤10 km 13>10 km 2

319 georeferenced · 367 without coordinates

Open the institutions mapphysical evidence686

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	220
Tempe, US	216
Edmonton, CA	98
McGill Universitylocation not on record	93
Royal Saskatchewan Museumlocation not on record	17
NEON Biorepository at Arizona State Universitylocation not on record	5
Helsinki, FI	5
TMPMlocation not on record	5
Espace pour la vielocation not on record	3
Kuopio, FI	2
Metsähallituslocation not on record	2
NTNU-VMlocation not on record	2
Essig Museum of Entomologylocation not on record	2
University of Alabamalocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
McGill University, Lyman Entomological Museumlocation not on record	1
BioFokuslocation not on record	1
Saint John, CA	1

18 institutions · 676 of 686 vouchered records shown · 10 without an institution code

09Environmental DNA64 detections

Where the DNA of Amara hyperborea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found64

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 64 detections have coordinates

Open the map3 countries0

evergreenForestshrubScrubdeciduousForestMesicForestField

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 11.0–16.6

Seasonal swing summer↔winter34.8 °C

Max temp (day)19.6 °C 14.9–20.7

Min temp (night)9.60 °C 7.40–12.6

Precipitation94.9 mm/mo 72.6–116

Air humidity54.6 % 52.2–61.9

Moisture balance-3.50 mm/mo -41.4–28.6

Vapour deficit802 Pa 524–818

Wind speed3.10 m/s 1.70–3.90

Cloud cover52.9 % 44.7–60.8

CHELSA 1981–2010, ~9 km grid, at location & month of 61 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)