Amara carinata

(LeConte, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records1 261

Data sources6

Biological traits0

DNA specimens89

eDNA detections4

Sources6 archives

Databases and archives Amara carinata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics89 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 261 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD89 specimens

01Narrative

Amara carinata is a species of beetle of the genus Amara in the family Carabidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding89 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara carinata has left across the world's sequence archives.

At a glance

DNA specimens89

BINs4

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus77 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

88Amostly conserved

259Cmostly conserved

628Gmostly conserved

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCTTTAAGTATATTAATTCGAGCTGAACTAGGAAACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes9

BINs4

Most divergent pair9.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara torridasame genus1.7%Amara alpinasame genus2.0%Amara pennsylvanicasame genus3.5%Amara convexiusculasame genus4.0%Amara lacustrissame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 261 records

Wild obs. + sensor5

Museum / vouchered1 256

Range

Area of Occupancy AOO860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 2

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 497≤1 km 28≤10 km 283>10 km 52

860 georeferenced · 396 without coordinates

Open the institutions mapphysical evidence1 256

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	512
Colorado State Universitylocation not on record	236
University of Alberta Museums (UAM)location not on record	228
Provo, US	75
WIlocation not on record	52
Royal Saskatchewan Museumlocation not on record	40
Universidad Católica de Manizaleslocation not on record	38
Essig Museum of Entomologylocation not on record	27
NEON Biorepository at Arizona State Universitylocation not on record	5
University of Alabamalocation not on record	5
EWIClocation not on record	4
US	4
University of Colorado, Museum of Natural Historylocation not on record	2
OSUClocation not on record	2
National Ecological Observatory Network, United Stateslocation not on record	2
Decorah, US	2
Awka, NG	2
CUlocation not on record	1
Cambridge, US	1
Albuquerque, US	1
Lubbock, US	1
University Park, US	1

22 institutions · 1 241 of 1 256 vouchered records shown · 15 without an institution code

09Environmental DNA4 detections

Where the DNA of Amara carinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

cultivatedCrops

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 17.0–22.2

Seasonal swing summer↔winter26.1 °C

Max temp (day)26.5 °C 25.6–29.9

Min temp (night)12.3 °C 11.2–15.9

Precipitation50.9 mm/mo 32.8–74.3

Air humidity50.5 % 50.4–51.3

Moisture balance-101 mm/mo -118–-92.8

Vapour deficit1,037 Pa 962–1,324

Wind speed4.80 m/s 4.60–4.80

Cloud cover28.0 % 23.8–30.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amara carinata

At a glance

Sources6 archives

At a glance

Record type1 261 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 261 records