Amara convexiuscula

(Marsham, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records459

Data sources9

Biological traits2

DNA specimens37

eDNA detections37

Sources9 archives

Databases and archives Amara convexiuscula's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility459 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF459 records

Environmental DNA1 datasets · 4 countries37 detections

DNA & barcodingBOLD37 specimens

Genome at a glanceGoaT · NCBI≈742 Mbp

01Narrative

Amara convexiuscula is a species of ground beetle native to Europe and Asia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)omnivore

Feeding guild (larval)herbivore

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara convexiuscula has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes1

eDNA detections37

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

574Tmostly conserved

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCTTTAAGTATATTAATTCGAGCTGAATTAGGAAACCCGGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes5

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara alpinasame genus3.5%Amara torridasame genus3.5%Amara carinatasame genus4.0%Amara pennsylvanicasame genus4.4%Amara bokorisame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amara convexiuscula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈742 489 420 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amara convexiuscula0.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.3% BUSCO

08Occurrence & distribution

Record type459 records

Wild obs. + sensor150

Museum / vouchered283

Fossil17

Other9

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 42≤1 km 38≤10 km 39>10 km 8

127 georeferenced · 23 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 33≤1 km 99≤10 km 71>10 km 3

206 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence283

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	55
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	27
Natural History Museum Rotterdamlocation not on record	22
Tartu, EE	16
NTNU-VMlocation not on record	16
Helsinki, FI	12
Copenhagen, DK	11
ZSMlocation not on record	7
MZLUlocation not on record	5
Kuopio, FI	5
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	4
Olocation not on record	4
Tilburg, NL	4
Tromsø, NO	3
NHMOlocation not on record	3
BioFokuslocation not on record	2
South Kensington, GB	2
neflocation not on record	2
Uniwersytet Wrocławskilocation not on record	2
Provincia di Livornolocation not on record	1
Oulu, FI	1
Philadelphia, US	1
NMOKlocation not on record	1
Metsähallituslocation not on record	1
Nijmegen, NL	1
Tallinn, EE	1
ZMAAlocation not on record	1

27 institutions · 210 of 283 vouchered records shown · 73 without an institution code

09Environmental DNA37 detections

Where the DNA of Amara convexiuscula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map4 countries0

in einer Lichtfallesavipohjainen ruderaattiSalzstelle

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 10.0–19.1

Seasonal swing summer↔winter18.0 °C

Max temp (day)20.8 °C 13.9–23.5

Min temp (night)13.6 °C 6.40–15.1

Precipitation65.9 mm/mo 54.5–75.4

Air humidity58.8 % 56.9–64.0

Moisture balance-46.5 mm/mo -69.4–-1.70

Vapour deficit782 Pa 504–949

Wind speed2.90 m/s 2.30–4.50

Cloud cover34.8 % 32.1–42.2

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)