Alpheus percyi

Coutière, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records44

Data sources6

Biological traits4

DNA specimens7

eDNA detections4

Sources6 archives

Databases and archives Alpheus percyi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

OBISOcean Biodiversity Information System18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS44 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD7 specimens

01Narrative

Alpheus percyi is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1908 door Coutière.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max40 m

Depth min35 m

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus percyi has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes2

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.2%

Haplotypes2

BINs3

Most divergent pair3.0%

Where individuals differ — all 27 variable positions, in barcode order

30Cvariable

54Cvariable

171Gmostly conserved

195Avariable

210Gvariable

229Cvariable

231Avariable

279Amostly conserved

288Amostly conserved

294Gmostly conserved

309Gvariable

360Cmostly conserved

387Avariable

417Cmostly conserved

420Cvariable

444Gvariable

456Cmostly conserved

483Cvariable

498Cvariable

504Tvariable

513Gvariable

543Gvariable

544Tvariable

552Cvariable

612Tmostly conserved

615Amostly conserved

621Avariable

ATAGTAGGAACCGCTCTTAGGCTACTAATCCGAGCCGAGCTAGGTCAACCAGGCAGACTTATTGGAAACGACCAAATTTATAATGTAATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus paracrinitussame genus16.7%Alpheus sororsame genus16.7%Alpheus euphrosynesame genus17.8%Alpheus gracilipessame genus17.8%Alpheus parvirostrissame genus17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type44 records

Museum / vouchered44

Range

Area of Occupancy AOO80 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 44 records without

Open the institutions mapphysical evidence44

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	16
Washington, US	5
Paris, FR	3
University of Floridalocation not on record	2

4 institutions · 26 of 44 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Alpheus percyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)