Alopecosa solitaria

(Herman, 1879) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records84

Data sources8

Biological traits4

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Alopecosa solitaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

World Spider Trait DBMasaryk University4 traits · 4 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources4 traits

Occurrence & distributionGBIF84 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Alopecosa solitaria is a wolf spider species in the genus Alopecosa found in Europe, Russia, and Kazakhstan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBuchar & Růžička 2002Gajdoš et al. 2014Řezáč et al. 2015Staręga et al. 2002

Ecology4

Light 2open

Moisture 2very dry

Regional IUCN Red List categoryVulnerable (VU)

Regional non-IUCN Red List categoryEndangered (EN)

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa solitaria has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTATTATTGGGTGTTTGGTCGGCTATGATGGGAACTGCTATATCAGTGTTGATTCGAATGGAATTAGGTAATCCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa fabrilissame genus5.9%Alopecosa schmidtisame genus5.9%Alopecosa taeniopussame genus5.9%Alopecosa striatipessame genus5.9%Alopecosa kochisame genus6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type84 records

Wild obs. + sensor33

Museum / vouchered42

Other9

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 10≤1 km 2≤10 km 4

16 georeferenced · 17 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤1 km 17≤10 km 1>10 km 1

19 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	12
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	5
Provincia di Livornolocation not on record	4
Ekaterinburg, RU	4
Frankfurt am Main	1

5 institutions · 26 of 42 vouchered records shown · 16 without an institution code

09Environmental DNA9 detections

Where the DNA of Alopecosa solitaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 6.40–20.5

Seasonal swing summer↔winter30.4 °C

Max temp (day)18.8 °C 10.1–24.6

Min temp (night)9.10 °C 0.6–16.0

Precipitation44.5 mm/mo 32.0–61.6

Air humidity57.4 % 53.4–58.3

Moisture balance-70.9 mm/mo -90.4–-34.6

Vapour deficit777 Pa 407–1,044

Wind speed3.70 m/s 3.10–4.20

Cloud cover43.6 % 38.9–49.1

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)