Alopecosa fabrilis

(Clerck, 1757) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records1 613

Data sources8

Biological traits10

DNA specimens11

eDNA detections10

Sources8 archives

Databases and archives Alopecosa fabrilis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 613 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

World Spider Trait DBMasaryk University10 traits · 28 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements28 literature sources10 traits

Occurrence & distributionGBIF1 613 records

Environmental DNA2 datasets · 6 countries10 detections

DNA & barcodingBOLD11 specimens

01Narrative

Alopecosa fabrilis, known as the great fox-spider, is a species of wolf spider in the family Lycosidae. It is predominantly found in Europe and was rediscovered in the United Kingdom in 2020 after being thought extinct.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 28 sources

Pekár 2014aEntling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Gajdoš & Svatoň 2001SLU 2020Staręga et al. 2001Henriksen & Hilmo 2015Harvey et al. 2017Liste France 2018Hyvärinen et al. 2019Bruun & Lissner 2019Finch 2004Kielhorn 2017Vangsgård et al. 1996Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick & Scheidler 2004Nährig et al. 2003Blick et al. 2016Noflatscher 1994Řezáč et al. 2015Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀12.85·♂11 mm

Predation1

Hunting guildground hunters

Ecology7

Circadian activitynocturnal

Light0.875 mm

Light 2partly shaded

Moisture 10.125 mm

Moisture 2dry

Regional IUCN Red List categoryVulnerable (VU)

Regional non-IUCN Red List categoryEndangered (2)

Defence1

Retreatground

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa fabrilis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections10

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 68 variable positions, in barcode order

1Gmostly conserved

2Amostly conserved

3Cmostly conserved

7Avariable

9Amostly conserved

10Tmostly conserved

14Tmostly conserved

15Tmostly conserved

16Avariable

17Tmostly conserved

19Amostly conserved

20Gmostly conserved

22Tmostly conserved

23Gmostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

32Gmostly conserved

33Cmostly conserved

34Tmostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

39Tmostly conserved

40Gvariable

42Gmostly conserved

43Gmostly conserved

45Cmostly conserved

46Tmostly conserved

47Gmostly conserved

49Tmostly conserved

50Amostly conserved

54Cmostly conserved

56Gmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

70Gmostly conserved

72Amostly conserved

73Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Gvariable

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

83Cmostly conserved

84Cmostly conserved

97Gmostly conserved

145Gmostly conserved

184Gmostly conserved

262Gmostly conserved

313Gmostly conserved

430Gvariable

472Amostly conserved

475Avariable

562Amostly conserved

616Cmostly conserved

GACTTTATATTTATTATTAGGTGTTTGATCAGCTATAATGGGGACTGCTATATCAGTATTAATTCGAATGGAATTGGGTAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes4

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa schmidtisame genus3.0%Alopecosa striatipessame genus3.5%Alopecosa taeniopussame genus3.8%Alopecosa solitariasame genus5.9%Alopecosa cuneatasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 613 records

Wild obs. + sensor1 171

Museum / vouchered442

Origin

Native55

Range

Area of Occupancy AOO1 960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 235≤1 km 127≤10 km 765>10 km 8

1 135 georeferenced · 36 without coordinates

Open the mapobservation + sensor1 171

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 142≤1 km 35≤10 km 117>10 km 14

308 georeferenced · 134 without coordinates

Open the institutions mapphysical evidence442

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tilburg, NL	94
Helsinki, FI	65
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	59
Brussels, BE	59
Akademia Pomorska w Słupskulocation not on record	19
Adam Mickiewicz University in Poznańlocation not on record	15
Uniwersytet w Białymstokulocation not on record	11
Frankfurt am Main	8
Copenhagen, DK	6
Ekaterinburg, RU	5
Tartu, EE	4
SLU Artdatabankenlocation not on record	4
	3
University of Tokyo, Department of Zoologylocation not on record	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
RMZlocation not on record	2
Geneva, CH	2
Paro, BT	2
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	2
South Kensington, GB	2
ZSMlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Natural History Museum, Londonlocation not on record	1
NTNU-VMlocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	1

27 institutions · 375 of 442 vouchered records shown · 67 without an institution code

09Environmental DNA10 detections

Where the DNA of Alopecosa fabrilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys2

Countries6

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map6 countries0

Dry Calluna heath, pineSandrasen

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 9.80–14.2

Seasonal swing summer↔winter18.9 °C

Max temp (day)15.1 °C 13.0–16.2

Min temp (night)9.90 °C 6.10–12.6

Precipitation72.4 mm/mo 54.5–78.1

Air humidity61.8 % 60.3–63.0

Moisture balance6.50 mm/mo

Vapour deficit583 Pa 468–632

Wind speed4.40 m/s

Cloud cover44.7 % 41.1–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alopecosa fabrilis

At a glance

Sources8 archives

Morphometry1

Predation1

Ecology7

Defence1

At a glance

Record type1 613 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 613 records