Alopecosa schmidti

(Hahn, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records140

Data sources7

Biological traits11

DNA specimens4

eDNA detections2

Sources7 archives

Databases and archives Alopecosa schmidti's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

World Spider Trait DBMasaryk University11 traits · 18 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements18 literature sources11 traits

Occurrence & distributionGBIF140 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD4 specimens

01Narrative

Alopecosa schmidti is een spinnensoort in de taxonomische indeling van de wolfspinnen (Lycosidae). Het dier behoort tot het geslacht Alopecosa. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1835 door Carl Wilhelm Hahn.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 18 sources

Schirmel et al. 2012Entling et al. 2007Buchar & Růžička 2002Gajdoš & Svatoň 2001Gajdoš et al. 2014Staręga et al. 2001SLU 2020Řezáč et al. 2015Blick et al. 2016Kielhorn 2017Finch 2004Martin 2012Hiebsch & Tolke 1996Sacher & Platen 2004Liste France 2018Staręga et al. 2002Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀14·♂10.5 mm

Predation3

Hunting guildground hunters

Simple hunting guild IIwanderer

Web buildingno

Ecology7

Ballooningless common

Light0.75 mm

Light 2open

Moisture 10.875 mm

Moisture 2very dry

Regional IUCN Red List categoryNear Threatened (NT)

Regional non-IUCN Red List categoryEndangered (EN)

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa schmidti has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)2.2%

Haplotypes2

BINs2

Most divergent pair2.9%

Where individuals differ — all 21 variable positions, in barcode order

58Tvariable

76Avariable

88Avariable

160Gvariable

175Tvariable

232Ahighly variable

259Tvariable

265Gvariable

295Avariable

343Avariable

373Avariable

436Gvariable

439Gvariable

475Avariable

493Gvariable

556Avariable

562Avariable

583Avariable

586Avariable

607Tvariable

628Avariable

GACTTTATATTTATTACTAGGTGTTTGATCAGCTATAATGGGAACTGCTATATCAGTTTTAATTCGAATGGAATTAGGTAATCCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa fabrilissame genus3.0%Alopecosa striatipessame genus4.0%Alopecosa taeniopussame genus4.3%Alopecosa solitariasame genus5.9%Alopecosa cuneatasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type140 records

Wild obs. + sensor55

Museum / vouchered84

Other1

Origin

Native1

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 20≤1 km 4≤10 km 3

27 georeferenced · 28 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤1 km 14≤10 km 5

19 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet w Białymstokulocation not on record	14
Adam Mickiewicz University in Poznańlocation not on record	12
Provincia di Livornolocation not on record	11
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	11
Ekaterinburg, RU	10
Zoologisches Museum Hamburglocation not on record	10
SNSDlocation not on record	4
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	3
Frankfurt am Main	2
ZSMlocation not on record	1
SNSB-Zoologische Staatssammlung Münchenlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

12 institutions · 80 of 84 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Alopecosa schmidti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.80 °C 6.30–9.20

Seasonal swing summer↔winter19.8 °C

Max temp (day)11.4 °C 10.1–12.8

Min temp (night)3.70 °C 1.60–5.70

Precipitation66.3 mm/mo 53.2–79.4

Air humidity63.9 % 62.3–65.5

Moisture balance9.50 mm/mo -6.00–24.9

Vapour deficit447 Pa 385–509

Wind speed2.40 m/s 1.90–2.80

Cloud cover44.5 % 43.6–45.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)