Alopecosa mutabilis

(Kulczyński, 1908) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records14

Data sources7

Biological traits3

DNA specimens15

eDNA detections15

Sources7 archives

Databases and archives Alopecosa mutabilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Alopecosa mutabilis is een spinnensoort in de taxonomische indeling van de wolfspinnen (Lycosidae). Het dier behoort tot het geslacht Alopecosa. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1908 door Wladislaus Kulczynski.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length7.3 mm

Cephalothorax length3.68 mm

Cephalothorax width2.71 mm

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa mutabilis has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

7Avariable

79Gmostly conserved

268Gmostly conserved

350Tvariable

370Amostly conserved

GACTTTATATTTAATATTAGGTGTTTGGTCAGCGATAATAGGTACTGCTATATCAGTATTAATTCGAATGGAATTAGGGAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes5

BIN1

Most divergent pair0.76%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa exasperanssame genus1.8%Alopecosa albostriatasame genus2.6%Alopecosa hirtipessame genus4.4%Alopecosa solivagasame genus4.7%Alopecosa sibiricasame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type14 records

Museum / vouchered14

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence14

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ekaterinburg, RU	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

2 institutions · 4 of 14 vouchered records shown · 10 without an institution code

09Environmental DNA15 detections

Where the DNA of Alopecosa mutabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

sandy-pebble littoral chore with thinned mos…floodplain with moss-shrub-herb coversouthern slope of a ridge with spotty herb-s…creek valley with a mixture of grass-dryad-m…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.20 °C 2.60–7.00

Seasonal swing summer↔winter34.4 °C

Max temp (day)9.60 °C 4.90–10.0

Min temp (night)3.20 °C 0.4–5.60

Precipitation28.8 mm/mo 20.3–42.9

Air humidity64.8 % 58.2–69.1

Moisture balance-54.0 mm/mo -67.2–-10.1

Vapour deficit339 Pa 220–420

Wind speed4.20 m/s 3.60–5.10

Cloud cover73.8 % 66.1–77.6

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)