Alopecosa hirtipes

(Kulczyński, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records223

Data sources7

Biological traits3

DNA specimens606

eDNA detections594

Sources7 archives

Databases and archives Alopecosa hirtipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility223 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI594 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics606 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF223 records

Environmental DNA1 datasets · 3 countries594 detections

DNA & barcodingBOLD606 specimens

01Narrative

Alopecosa hirtipes is een spinnensoort in de taxonomische indeling van de wolfspinnen (Lycosidae). Het dier behoort tot het geslacht Alopecosa. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1907 door Wladislaus Kulczynski.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀12.15·♂10.05 mm

Cephalothorax length♀5.85·♂5.18 mm

Cephalothorax width♀4.46·♂3.97 mm

05DNA & barcoding606 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa hirtipes has left across the world's sequence archives.

At a glance

DNA specimens606

BINs1

Marker genes2

eDNA detections594

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus593 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

340Amostly conserved

358Gmostly conserved

583Cmostly conserved

TTTGTATTTAATATTGGGTGTTTGGTCGGCAATAATAGGTACTGCTATATCAGTATTAATTCGGATGGAATTAGGTAATCCTGGAAGTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes28

BIN1

Most divergent pair5.4%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa solivagasame genus1.7%Alopecosa koponenisame genus2.8%Alopecosa albostriatasame genus4.3%Alopecosa mutabilissame genus4.4%Alopecosa sibiricasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type223 records

Wild obs. + sensor121

Museum / vouchered102

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 4≤1 km 1>10 km 2

7 georeferenced · 114 without coordinates

Open the mapobservation + sensor121

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 2≤10 km 3>10 km 3

8 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	23
Ekaterinburg, RU	7
Denver, US	3
Edmonton, CA	2
Centre for Biodiversity Genomicslocation not on record	2
Cambridge, US	1
WIlocation not on record	1
University of Alaska Museumlocation not on record	1

8 institutions · 40 of 102 vouchered records shown · 62 without an institution code

09Environmental DNA594 detections

Where the DNA of Alopecosa hirtipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found594

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 594 detections have coordinates

Open the map3 countries0

4. Native Grassland | 4.1. Tundra4. Grassland | 4.1. Grassland - TundraTundrawet river valley with sedge-moss-willow vege…4. Grassland | 4.1 Grassland - Tundralichen-moss-herb-grass placor tundra commini…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 3.70–10.4

Seasonal swing summer↔winter41.6 °C

Max temp (day)11.5 °C 7.20–14.7

Min temp (night)4.00 °C 1.10–6.10

Precipitation43.1 mm/mo 32.9–69.3

Air humidity62.3 % 60.1–63.9

Moisture balance-32.9 mm/mo -62.0–51.1

Vapour deficit390 Pa 289–505

Wind speed4.40 m/s 4.20–4.90

Cloud cover47.8 % 46.3–61.5

CHELSA 1981–2010, ~9 km grid, at location & month of 582 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)