Alopecosa exasperans

(O.Pickard-Cambridge, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records102

Data sources8

Biological traits3

DNA specimens119

eDNA detections118

Sources8 archives

Databases and archives Alopecosa exasperans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI118 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics119 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF102 records

Environmental DNA1 datasets · 1 countries118 detections

DNA & barcodingBOLD119 specimens

01Narrative

Alopecosa exasperans is a species of wolf spider in the family Lycosidae. It is found in Canada and Greenland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀8.7·♂7.85 mm

Cephalothorax length♀3.85·♂3.66 mm

Cephalothorax width♀3.01·♂2.82 mm

05DNA & barcoding119 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa exasperans has left across the world's sequence archives.

At a glance

DNA specimens119

BINs1

Marker genes2

eDNA detections118

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus118 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes1

BIN1

CTTTGTATTTAATATTAGGTGTTTGGTCAGCGATAATAGGTACTGCTATATCAGTATTAATTCGAATGGAATTAGGGAATCCTGGAAGTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa mutabilissame genus1.8%Alopecosa albostriatasame genus2.9%Alopecosa solivagasame genus4.6%Alopecosa hirtipessame genus4.6%Alopecosa koponenisame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type102 records

Wild obs. + sensor12

Museum / vouchered90

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 3≤10 km 1

7 georeferenced · 5 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	40
Denver, US	2

2 institutions · 42 of 90 vouchered records shown · 48 without an institution code

09Environmental DNA118 detections

Where the DNA of Alopecosa exasperans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found118

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 118 detections have coordinates

Open the map1 country0

4. Grassland | 4.1. Tundra4. Grassland | 4.1 Grassland - Tundra4. Grassland | 4.1. Grassland - Tundra4. Native Grassland | 4.1. TundraTundra

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.00 °C 6.40–9.90

Seasonal swing summer↔winter41.6 °C

Max temp (day)10.0 °C 9.90–13.7

Min temp (night)5.00 °C 3.40–5.60

Precipitation35.0 mm/mo 27.3–62.3

Air humidity61.8 % 58.2–63.6

Moisture balance-52.4 mm/mo -67.2–-25.8

Vapour deficit420 Pa 351–467

Wind speed4.50 m/s 4.30–5.10

Cloud cover48.7 % 46.3–73.8

CHELSA 1981–2010, ~9 km grid, at location & month of 113 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)