Alopecosa farinosa

(Herman, 1879) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records6 213

Data sources7

Biological traits6

DNA specimens6

eDNA detections1

Sources7 archives

Databases and archives Alopecosa farinosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 213 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

World Spider Trait DBMasaryk University6 traits · 4 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources6 traits

Occurrence & distributionGBIF6 213 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD6 specimens

01Narrative

Alopecosa barbipes là một phân loài nhện trong họ Lycosidae. Loài này thuộc chi Alopecosa. Alopecosa barbipes oreophila được Eugène Simon miêu tả năm 1937.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEntling et al. 2007Buchar & Růžička 2002Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀9·♂7 mm

Predation1

Hunting guildground hunters

Ecology4

Light0.625 mm

Light 2partly shaded

Moisture 10.25 mm

Moisture 2dry

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa farinosa has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P611 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

7Gmostly conserved

13Amostly conserved

37Amostly conserved

40Amostly conserved

58Gmostly conserved

83Cmostly conserved

160Amostly conserved

190Amostly conserved

199Gmostly conserved

208Amostly conserved

229Amostly conserved

289Gmostly conserved

316Gmostly conserved

322Gmostly conserved

349Amostly conserved

355Amostly conserved

373Amostly conserved

421Amostly conserved

439Amostly conserved

475Amostly conserved

481Gmostly conserved

535Amostly conserved

541Gvariable

GACTTTGTATTTATTATTAGGTGTTTGGTCGGCTATAATAGGGACTGCTATATCAGTGTTGATTCGAATAGAATTAGGTAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes5

BINs2

Most divergent pair3.3%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa pentherisame genus4.4%Alopecosa taeniatasame genus4.9%Alopecosa aculeatasame genus5.1%Alopecosa cursorsame genus5.1%Alopecosa pulverulentasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 213 records

Wild obs. + sensor868

Museum / vouchered5 344

Other1

Origin

Native314

Range

Area of Occupancy AOO888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 56≤1 km 70≤10 km 491>10 km 2

619 georeferenced · 249 without coordinates

Open the mapobservation + sensor868

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 16≤10 km 190

206 georeferenced · 5 138 without coordinates

Open the institutions mapphysical evidence5 344

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	4 903
Adam Mickiewicz University in Poznańlocation not on record	213
Paro, BT	136
Bern, CH	31
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	16
EIBElocation not on record	8
Ekaterinburg, RU	7
	6
Bonn, DE	4
Frankfurt am Main	3
Musee d'Histoire Naturallelocation not on record	2
Geneva, CH	2

12 institutions · 5 331 of 5 344 vouchered records shown · 13 without an institution code

09Environmental DNA1 detections

Where the DNA of Alopecosa farinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 15.6–15.6

Seasonal swing summer↔winter19.0 °C

Max temp (day)20.0 °C

Min temp (night)9.40 °C

Precipitation80.5 mm/mo

Air humidity60.7 %

Moisture balance-41.4 mm/mo

Vapour deficit697 Pa

Wind speed1.00 m/s

Cloud cover30.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alopecosa farinosa

At a glance

Sources7 archives

Morphometry1

Predation1

Ecology4

At a glance

Record type6 213 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 213 records