Alopecosa cursor

(Hahn, 1831) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records599

Data sources7

Biological traits8

DNA specimens26

eDNA detections22

Sources7 archives

Databases and archives Alopecosa cursor's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility599 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

World Spider Trait DBMasaryk University8 traits · 24 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements24 literature sources8 traits

Occurrence & distributionGBIF599 records

Environmental DNA1 datasets · 3 countries22 detections

DNA & barcodingBOLD26 specimens

01Narrative

De zandpanterspin is een spinnensoort uit de familie van de wolfspinnen (Lycosidae). De wetenschappelijke naam van de soort werd in 1831 gepubliceerd door Carl Wilhelm Hahn. De spin komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 24 sources

Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Gajdoš & Svatoň 2001SLU 2020Staręga et al. 2001Bruun & Lissner 2019Finch 2004Kielhorn 2017Vangsgård et al. 1996Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Liste France 2018Blick & Scheidler 2004Noflatscher 1994Nährig et al. 2003Blick et al. 2016Řezáč et al. 2015Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀9·♂7 mm

Predation1

Hunting guildground hunters

Ecology6

Light0.875 mm

Light 2open

Moisture 10.125 mm

Moisture 2very dry

Regional IUCN Red List categoryNear Threatened (NT)

Regional non-IUCN Red List categoryData Deficient (D)

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa cursor has left across the world's sequence archives.

At a glance

DNA specimens26

BINs4

Marker genes1

eDNA detections22

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 66 variable positions, in barcode order

1Amostly conserved

14Tmostly conserved

19Amostly conserved

28Gmostly conserved

31Gmostly conserved

37Amostly conserved

40Amostly conserved

43Amostly conserved

58Gmostly conserved

70Amostly conserved

88Amostly conserved

94Amostly conserved

100Tmostly conserved

112Amostly conserved

145Gmostly conserved

148Gmostly conserved

160Gvariable

163Amostly conserved

166Gvariable

184Amostly conserved

196Gmostly conserved

199Amostly conserved

211Gmostly conserved

214Amostly conserved

262Amostly conserved

268Amostly conserved

286Avariable

289Gmostly conserved

310Gmostly conserved

316Gmostly conserved

319Amostly conserved

322Gmostly conserved

337Tmostly conserved

343Tmostly conserved

352Gmostly conserved

355Gmostly conserved

359Amostly conserved

367Tmostly conserved

368Gvariable

369Cmostly conserved

370Tmostly conserved

373Tmostly conserved

382Amostly conserved

415Gmostly conserved

433Gmostly conserved

436Tmostly conserved

439Gmostly conserved

454Tmostly conserved

472Amostly conserved

473Tmostly conserved

475Amostly conserved

487Amostly conserved

492Amostly conserved

511Gmostly conserved

514Amostly conserved

517Tmostly conserved

526Amostly conserved

538Amostly conserved

541Amostly conserved

583Gmostly conserved

586Tmostly conserved

592Amostly conserved

613Tmostly conserved

628Amostly conserved

641Tmostly conserved

643Gmostly conserved

AACTTTATATTTATTATTAGGTGTTTGGTCGGCAATAATAGGAACTGCTATATCAGTGTTAATTCGAATAGAATTAGGTAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes15

BINs4

Most divergent pair9.0%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa pentherisame genus1.5%Alopecosa farinosasame genus5.1%Alopecosa pulverulentasame genus5.6%Alopecosa cuneatasame genus5.8%Alopecosa trabalissame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type599 records

Wild obs. + sensor349

Museum / vouchered234

Other16

Range

Area of Occupancy AOO816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 46≤1 km 17≤10 km 220>10 km 4

287 georeferenced · 62 without coordinates

Open the mapobservation + sensor349

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 7≤1 km 11≤10 km 27>10 km 2

47 georeferenced · 187 without coordinates

Open the institutions mapphysical evidence234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	117
Ekaterinburg, RU	15
Frankfurt am Main	13
Uniwersytet w Białymstokulocation not on record	12
Tilburg, NL	6
Helsinki, FI	3
	3
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	2
SLU Artdatabankenlocation not on record	2
Tartu, EE	1
MZLUlocation not on record	1

12 institutions · 178 of 234 vouchered records shown · 50 without an institution code

09Environmental DNA22 detections

Where the DNA of Alopecosa cursor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 6.40–14.2

Seasonal swing summer↔winter30.4 °C

Max temp (day)16.1 °C 10.1–18.6

Min temp (night)6.60 °C 0.6–9.00

Precipitation40.4 mm/mo 32.0–95.9

Air humidity54.7 % 53.0–59.2

Moisture balance-48.2 mm/mo -87.1–10.9

Vapour deficit621 Pa 407–766

Wind speed3.80 m/s 3.60–5.80

Cloud cover40.7 % 38.1–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)