Aloeides trimeni

Tite & Dickson, 1973 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Aloeides

At a glance

Occurrence records34

Data sources8

Biological traits0

DNA specimens16

eDNA detections11

Sources8 archives

Databases and archives Aloeides trimeni's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility34 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF34 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD16 specimens

01Narrative

Aloeides trimeni, the Trimen's copper, is a butterfly of the family Lycaenidae. It is found in South Africa, where it is found from coastal KwaZulu-Natal to the Drakensberg, north into Mpumalanga and Limpopo. The wingspan is 22–33 mm for males and 24–35 mm for females. Adults are on wing from September to December (with a peak in October) and from January to April (with a peak in February). There are two generations per year. The larvae feed on Aspalathus species and Hermannia depressa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloeides trimeni has left across the world's sequence archives.

At a glance

DNA specimens16

BINs5

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 62 variable positions, in barcode order

28Tmostly conserved

31Tmostly conserved

35Gmostly conserved

46Tmostly conserved

47Tmostly conserved

53Gmostly conserved

73Avariable

79Cmostly conserved

82Tmostly conserved

106Avariable

115Tmostly conserved

127Tmostly conserved

151Cvariable

166Amostly conserved

215Gmostly conserved

229Amostly conserved

247Tvariable

260Cmostly conserved

262Tmostly conserved

263Tmostly conserved

268Cvariable

271Tmostly conserved

278Tmostly conserved

283Avariable

295Tmostly conserved

316Tmostly conserved

334Amostly conserved

337Cmostly conserved

352Amostly conserved

356Gmostly conserved

373Tmostly conserved

397Cmostly conserved

403Tmostly conserved

404Cmostly conserved

406Tmostly conserved

409Tmostly conserved

412Amostly conserved

413Amostly conserved

415Tmostly conserved

420Cmostly conserved

439Tmostly conserved

460Tvariable

467Amostly conserved

479Amostly conserved

480Tmostly conserved

481Amostly conserved

505Tvariable

509Gmostly conserved

544Tmostly conserved

550Tmostly conserved

559Amostly conserved

565Amostly conserved

571Amostly conserved

578Tmostly conserved

583Tmostly conserved

592Tmostly conserved

601Amostly conserved

613Tmostly conserved

616Amostly conserved

631Tmostly conserved

634Amostly conserved

650Cvariable

TTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACATCTTTAAGAGTTTTAATTCGTATAGAATTAGGAACCCCTGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes6

BINs5

Most divergent pair6.4%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aloeides malutisame genus2.1%Aloeides macmasterisame genus2.6%Aloeides pierussame genus2.7%Aloeides griseussame genus2.8%Aloeides damarensissame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type34 records

Wild obs. + sensor5

Museum / vouchered29

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 2 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 29 records without

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Durban Natural Science Museumlocation not on record	29

1 institutions · 29 of 29 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Aloeides trimeni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 14.8–21.2

Seasonal swing summer↔winter10.9 °C

Max temp (day)25.7 °C 20.4–27.4

Min temp (night)13.9 °C 9.20–16.5

Precipitation81.2 mm/mo 52.6–137

Air humidity58.3 % 54.1–61.4

Moisture balance-62.9 mm/mo -121–-5.60

Vapour deficit970 Pa 684–1,174

Wind speed3.50 m/s 3.00–3.70

Cloud cover27.7 % 15.3–40.6

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)