Aloeides pierus

(Cramer, 1782) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Aloeides

At a glance

Occurrence records1 180

Data sources8

Biological traits0

DNA specimens31

eDNA detections4

Sources8 archives

Databases and archives Aloeides pierus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 180 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 180 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD31 specimens

01Narrative

Aloeides pierus, the dull copper, is a butterfly of the family Lycaenidae. It is found in South Africa, where it is found in the Western, Northern and Eastern Cape, as well as the Free State. The wingspan is 25–30 mm. Adults are on wing from September to April, with peaks in October and February. There are multiple generations per year. The larvae feed on Aspalathus species. They shelter in the nests of Lepisiota capensis ants during the day.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloeides pierus has left across the world's sequence archives.

At a glance

DNA specimens31

BINs2

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P598 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 102 variable positions, in barcode order

5Tmostly conserved

6Amostly conserved

7Gmostly conserved

9Amostly conserved

15Tmostly conserved

21Amostly conserved

22Gmostly conserved

25Tmostly conserved

33Tmostly conserved

35Tmostly conserved

36Amostly conserved

43Gmostly conserved

48Cmostly conserved

51Amostly conserved

54Amostly conserved

58Tmostly conserved

72Tmostly conserved

84Tmostly conserved

99Tmostly conserved

102Tmostly conserved

135Amostly conserved

163Tmostly conserved

165Amostly conserved

168Amostly conserved

180Amostly conserved

186Amostly conserved

198Amostly conserved

201Tmostly conserved

204Amostly conserved

216Tmostly conserved

231Tmostly conserved

232Tmostly conserved

240Tmostly conserved

243Amostly conserved

247Tmostly conserved

249Amostly conserved

250Tmostly conserved

252Amostly conserved

264Cmostly conserved

270Tmostly conserved

273Amostly conserved

279Tmostly conserved

282Amostly conserved

285Tmostly conserved

288Tmostly conserved

291Amostly conserved

303Amostly conserved

306Cmostly conserved

312Amostly conserved

321Amostly conserved

325Gmostly conserved

327Amostly conserved

330Tmostly conserved

339Amostly conserved

348Tmostly conserved

366Cmostly conserved

367Cmostly conserved

369Tmostly conserved

373Cmostly conserved

375Tmostly conserved

378Amostly conserved

382Gmostly conserved

384Amostly conserved

387Amostly conserved

390Amostly conserved

402Amostly conserved

411Cmostly conserved

417Amostly conserved

420Tmostly conserved

443Amostly conserved

445Tmostly conserved

448Tmostly conserved

449Cmostly conserved

450Amostly conserved

452Tmostly conserved

453Cmostly conserved

463Tmostly conserved

472Amostly conserved

478Tmostly conserved

480Cmostly conserved

483Amostly conserved

492Tmostly conserved

495Amostly conserved

496Tmostly conserved

502Tmostly conserved

513Tmostly conserved

519Amostly conserved

522Tmostly conserved

528Amostly conserved

534Amostly conserved

537Tmostly conserved

547Tmostly conserved

549Amostly conserved

552Gvariable

558Tmostly conserved

562Cmostly conserved

567Tmostly conserved

570Amostly conserved

582Tmostly conserved

585Cmostly conserved

588Tmostly conserved

594Amostly conserved

ATAGTAGGAACATCTTTAAGAGTTTTAATTCGTATAGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.4%

Haplotypes7

BINs2

Most divergent pair15.1%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aloeides malutisame genus1.8%Aloeides trimenisame genus2.7%Aloeides macmasterisame genus3.8%Aloeides henningisame genus4.2%Aloeides griseussame genus4.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 180 records

Wild obs. + sensor678

Museum / vouchered502

Range

Area of Occupancy AOO1 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 281≤1 km 95≤10 km 76>10 km 4

456 georeferenced · 222 without coordinates

Open the mapobservation + sensor678

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 8>10 km 3

11 georeferenced · 491 without coordinates

Open the institutions mapphysical evidence502

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Teylers Museumlocation not on record	230
Durban Natural Science Museumlocation not on record	128
Iziko South African Museumlocation not on record	35
Sydney, AU	34
Cape Town, ZA	31
Northern Michigan Universitylocation not on record	22
Cambridge, US	9
KwaZulu-Natal Museumlocation not on record	7
New Haven, US	2
University of Johannesburglocation not on record	2
East London Museumlocation not on record	1
Research Collection of Dave Edgelocation not on record	1

12 institutions · 502 of 502 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aloeides pierus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 15.7–18.9

Seasonal swing summer↔winter13.8 °C

Max temp (day)25.0 °C 22.8–25.6

Min temp (night)9.70 °C 8.10–11.4

Precipitation26.0 mm/mo 21.4–35.4

Air humidity49.9 % 49.1–51.1

Moisture balance-125 mm/mo -125–-103

Vapour deficit1,051 Pa 881–1,099

Wind speed3.60 m/s 3.60–4.90

Cloud cover17.9 % 16.6–18.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aloeides pierus

At a glance

Sources8 archives

At a glance

Record type1 180 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 180 records