Aloeides macmasteri

Tite & Dickson, 1973 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Aloeides

At a glance

Occurrence records128

Data sources8

Biological traits0

DNA specimens14

eDNA detections22

Sources8 archives

Databases and archives Aloeides macmasteri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility128 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF128 records

Environmental DNA1 datasets · 1 countries22 detections

DNA & barcodingBOLD14 specimens

01Narrative

Aloeides macmasteri, the McMaster's copper, is a butterfly of the family Lycaenidae. It is found in South Africa, where it is widespread but localised and known from the Western Cape, then across the Great Karoo to Namaqualand. It is also found from Coega to Grassland in the Eastern Cape. The wingspan is 28–32 mm for males and 30–35 mm females. Adults are on wing from September to November and from February to April. There are two generations per year.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloeides macmasteri has left across the world's sequence archives.

At a glance

DNA specimens14

BINs3

Marker genes1

eDNA detections22

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P579 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

9Amostly conserved

15Tmostly conserved

22Gmostly conserved

43Gmostly conserved

51Tmostly conserved

58Tmostly conserved

84Tmostly conserved

96Amostly conserved

120Cmostly conserved

135Tmostly conserved

163Tmostly conserved

180Amostly conserved

216Tmostly conserved

231Tmostly conserved

232Cmostly conserved

237Amostly conserved

247Cmostly conserved

249Amostly conserved

250Tmostly conserved

264Tmostly conserved

270Tmostly conserved

279Tmostly conserved

282Amostly conserved

300Amostly conserved

303Gmostly conserved

306Cmostly conserved

330Tmostly conserved

355Gmostly conserved

366Cmostly conserved

378Tmostly conserved

381Tmostly conserved

382Gmostly conserved

384Amostly conserved

387Amostly conserved

408Cmostly conserved

411Tmostly conserved

448Tmostly conserved

449Cmostly conserved

453Tmostly conserved

478Gmostly conserved

480Tmostly conserved

492Tmostly conserved

495Amostly conserved

496Tmostly conserved

519Tmostly conserved

528Amostly conserved

537Tmostly conserved

547Cmostly conserved

552Tmostly conserved

561Cmostly conserved

562Tmostly conserved

567Tmostly conserved

570Tmostly conserved

579Tmostly conserved

ATAGTAGGAACATCTTTAAGAGTTTTAATTCGTATAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes6

BINs3

Most divergent pair7.4%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aloeides henningisame genus2.1%Aloeides stevensonisame genus2.2%Aloeides trimenisame genus2.6%Aloeides malutisame genus3.1%Aloeides pierussame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type128 records

Wild obs. + sensor20

Museum / vouchered108

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 1

6 georeferenced · 14 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Teylers Museumlocation not on record	61
Sydney, AU	26
Durban Natural Science Museumlocation not on record	12
KwaZulu-Natal Museumlocation not on record	3
Cambridge, US	2
Iziko South African Museumlocation not on record	2
Northern Michigan Universitylocation not on record	1
Cape Town, ZA	1

8 institutions · 108 of 108 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Aloeides macmasteri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map1 country0

Natural

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 14.0–20.4

Seasonal swing summer↔winter10.5 °C

Max temp (day)24.1 °C 18.3–26.8

Min temp (night)12.4 °C 7.60–17.0

Precipitation48.6 mm/mo 20.3–137

Air humidity59.3 % 48.6–61.2

Moisture balance-96.9 mm/mo -150–-5.10

Vapour deficit920 Pa 634–1,162

Wind speed3.90 m/s 3.10–5.40

Cloud cover17.6 % 10.0–33.5

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)