Alloteuthis subulata

(Lamarck, 1798) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Myopsida/Loliginidae/Alloteuthis

At a glance

Occurrence records20 795

Data sources10

Biological traits8

DNA specimens115

eDNA detections112

Sources10 archives

Databases and archives Alloteuthis subulata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 986 records↗

OBISOcean Biodiversity Information System17 809 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI112 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics115 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS20 795 records

Environmental DNA1 datasets · 4 countries112 detections

DNA & barcodingBOLD115 specimens

01Narrative

Alloteuthis subulata, the European common squid, is a species of squid in the genus Alloteuthis and the family Loliginidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length21.5 cm

Life cycle & reproduction1

Max. longevity12 months

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max630 m

Depth min0 m

Vulnerability10

05DNA & barcoding115 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alloteuthis subulata has left across the world's sequence archives.

At a glance

DNA specimens115

BINs2

Marker genes1

eDNA detections112

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P445 bp consensus109 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

297Tmostly conserved

ATCTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTGGGAATTGATTAGTACCTTTAATATTAGGTGCACCAGATATAGCTTTTCCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes6

BINs2

Most divergent pair4.7%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alloteuthis mediasame genus4.5%Alloteuthis africanasame genus6.7%Loligo reynaudiisame family12.8%Loligo vulgarissame family13.5%Uroteuthis sibogaesame family13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type20 795 records

Wild obs. + sensor2 238

Museum / vouchered1 494

Other17 063

Range

Area of Occupancy AOO18 512 km²

Depth

0–200 m sunlit16 762

200–1000 m twilight49

1–4 km midnight0

>4 km abyssal0

median 33.2 m · max 630 m · 16 811 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 1 503≤1 km 310≤10 km 401>10 km 1

2 215 georeferenced · 23 without coordinates

Open the mapobservation + sensor2 238

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 8≤1 km 15≤10 km 7>10 km 26

56 georeferenced · 1 438 without coordinates

Open the institutions mapphysical evidence1 494

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	364
RWSlocation not on record	131
Frankfurt am Main	54
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	20
IEOlocation not on record	14
DASSHlocation not on record	11
Natural History Museum Rotterdamlocation not on record	9
IEO-COMA-CSIClocation not on record	3
Vlaams Instituut voor de Zeelocation not on record	3
Stockholm, SE	2
UM-RSMASlocation not on record	2
Philadelphia, US	2
South Kensington, GB	2
PNHSlocation not on record	2
Cambridge, US	1
CLOlocation not on record	1
Washington, US	1
MZLUlocation not on record	1

18 institutions · 623 of 1 494 vouchered records shown · 66 without an institution code

09Environmental DNA112 detections

Where the DNA of Alloteuthis subulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found112

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 112 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 16.7–18.2

Seasonal swing summer↔winter7.90 °C

Max temp (day)19.6 °C 18.2–20.1

Min temp (night)16.8 °C 15.4–17.2

Precipitation73.0 mm/mo 21.0–99.0

Air humidity64.5 % 61.4–68.3

Vapour deficit737 Pa 488–773

Cloud cover39.6 % 39.0–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 87 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alloteuthis subulata

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type20 795 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type20 795 records