Alloteuthis media

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Myopsida/Loliginidae/Alloteuthis

At a glance

Occurrence records2 258

Data sources9

Biological traits7

DNA specimens327

eDNA detections0

Sources9 archives

Databases and archives Alloteuthis media's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility765 records↗

OBISOcean Biodiversity Information System1 493 records↗

BOLD SystemsCentre for Biodiversity Genomics327 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS2 258 records

DNA & barcodingBOLD327 specimens

01Narrative

Alloteuthis media, the midsize squid or little squid is a species of squid in the family Loliginidae from the eastern Atlantic and the Mediterranean Sea. It is generally a by catch species in trawl fisheries, although there is an active fishery in the western Mediterranean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length8.8 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max674 m

Depth min0 m

05DNA & barcoding327 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alloteuthis media has left across the world's sequence archives.

At a glance

DNA specimens327

BINs1

Marker genes1

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P453 bp consensus299 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

152Amostly conserved

257Cvariable

272Gmostly conserved

TTATTATAATTTTCTTCATAGTTATACCTATTATAATTGGAGGTTTTGGGAATTGATTAGTACCTTTAATATTAGGTGCACCAGATATAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 43 variants.

Diversity (π)0.30%

Haplotypes43

BIN1

Most divergent pair1.3%

AfricaOtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alloteuthis subulatasame genus4.5%Alloteuthis africanasame genus7.0%Illex illecebrosussame order13.5%Illex coindetiisame order13.7%Loligo forbesiisame family13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 258 records

Wild obs. + sensor444

Museum / vouchered234

Other1 580

Range

Area of Occupancy AOO3 028 km²

Depth

0–200 m sunlit1 385

200–1000 m twilight82

1–4 km midnight0

>4 km abyssal0

median 88.7 m · max 687.8 m · 1 467 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 17≤1 km 407≤10 km 5

429 georeferenced · 15 without coordinates

Open the mapobservation + sensor444

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 1

7 georeferenced · 227 without coordinates

Open the institutions mapphysical evidence234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ICATMARlocation not on record	43
Washington, US	7
Frankfurt am Main	7
Stockholm, SE	3
IEO-COMA-CSIClocation not on record	2
Cambridge, US	2
South Kensington, GB	2
DASSHlocation not on record	2
Philadelphia, US	1
UM-RSMASlocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
Chicago, US	1

12 institutions · 72 of 234 vouchered records shown · 152 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alloteuthis media

At a glance

Sources9 archives

Size & morphology1

Habitat & environment3

Uses & economy1

Other traits2

At a glance

Record type2 258 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 12 geolocated

Record type2 258 records