Loligo forbesii

Steenstrup, 1856 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Myopsida/Loliginidae/Loligo

At a glance

Occurrence records57 376

Data sources10

Biological traits7

DNA specimens57

eDNA detections57

Sources10 archives

Databases and archives Loligo forbesii's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 163 records↗

OBISOcean Biodiversity Information System53 213 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS57 376 records

Environmental DNA1 datasets · 5 countries57 detections

DNA & barcodingBOLD57 specimens

01Narrative

Loligo forbesii (sometimes erroneouslyBouchet, P. and S. Gofas. (2013). Loligo forbesi Steenstrup, 1856. World Register of Marine Species. Accessed 5 June 2013. spelled forbesi), known commonly as the veined squid and long-finned squid, is a commercially important species of squid in the family Loliginidae, the pencil squids.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length93.7 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max431 m

Depth min68 m

Vulnerability56

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Loligo forbesii has left across the world's sequence archives.

At a glance

DNA specimens57

BINs1

Marker genes3

eDNA detections57

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

16Tmostly conserved

19Cmostly conserved

55Amostly conserved

136Cmostly conserved

190Gmostly conserved

217Tmostly conserved

346Gmostly conserved

391Cmostly conserved

415Gmostly conserved

448Cmostly conserved

550Cvariable

616Tmostly conserved

625Gmostly conserved

AACATTATATTTTATTTTCGGTATTTGAGCAGGATTAGTTGGTACTTCATTAAGATTGATAATTCGAACAGAATTAGGAAAACCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes4

BIN1

Most divergent pair1.5%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Loligo reynaudiisame genus9.9%Loligo vulgarissame genus10.0%Uroteuthis edulissame family13.7%Uroteuthis noctilucasame family14.0%Idiosepius paradoxussame order14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type57 376 records

Wild obs. + sensor3 894

Museum / vouchered1 804

Other51 678

Range

Area of Occupancy AOO24 140 km²

Depth

0–200 m sunlit52 692

200–1000 m twilight458

1–4 km midnight0

>4 km abyssal0

median 60 m · max 740 m · 53 150 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 1 047≤1 km 46≤10 km 273>10 km 1 109

2 475 georeferenced · 1 419 without coordinates

Open the mapobservation + sensor3 894

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 53≤1 km 1≤10 km 4>10 km 5

63 georeferenced · 1 741 without coordinates

Open the institutions mapphysical evidence1 804

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	30
Paris, FR	16
ELMClocation not on record	12
Sydney, AU	8
Gothenburg, SE	7
Denver, US	7
Washington, US	7
Cambridge, US	4
Stockholm, SE	3
Natural History Museum Rotterdamlocation not on record	3
IEO-COMA-CSIClocation not on record	2
National Science Museum (Natural History)location not on record	2
UM-RSMASlocation not on record	2
South Kensington, GB	2
Copenhagen, DK	2
RWSlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
UGent-MARBIOLlocation not on record	1
Bailey-Matthews National Shell Museumlocation not on record	1
PNHSlocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1

21 institutions · 113 of 1 804 vouchered records shown · 65 without an institution code

09Environmental DNA57 detections

Where the DNA of Loligo forbesii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 5.50–16.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)14.5 °C 6.40–17.5

Min temp (night)13.3 °C 4.60–15.9

Precipitation72.5 mm/mo 54.2–87.3

Air humidity65.0 % 60.8–67.3

Vapour deficit552 Pa 352–671

Cloud cover52.1 % 41.6–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Loligo forbesii

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type57 376 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type57 376 records