Loligo vulgaris

Lamarck, 1798 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Myopsida/Loliginidae/Loligo

At a glance

Occurrence records15 432

Data sources10

Biological traits8

DNA specimens240

eDNA detections113

Sources10 archives

Databases and archives Loligo vulgaris's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 199 records↗

OBISOcean Biodiversity Information System10 233 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI113 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics240 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS15 432 records

Environmental DNA2 datasets · 7 countries113 detections

DNA & barcodingBOLD240 specimens

01Narrative

The European squid or common squid (Loligo vulgaris) is a large squid belonging to the family Loliginidae. It occurs abundantly in coastal waters from the North Sea to at least the west coast of Africa. This species lives from sea level to depths of 500 m. Its mantle is up to 40 cm long. The species is extensively exploited by commercial fisheries. Loligo reynaudii, the Cape Hope squid, was previously treated as a subspecies of L. vulgaris.Vecchione, M. & R.E. Young. (2010). Loligo reynaudii Orbigny 1845. Tree of Life Web Project.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology2

Body length64 cm

Body mass1 500 g

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max500 m

Depth min0 m

Vulnerability18.74

05DNA & barcoding240 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Loligo vulgaris has left across the world's sequence archives.

At a glance

DNA specimens240

BINs2

Marker genes3

eDNA detections113

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P542 bp consensus226 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

11Amostly conserved

44Gmostly conserved

104Cvariable

140Amostly conserved

149Gvariable

161Avariable

164Gvariable

197Amostly conserved

221Gvariable

239Amostly conserved

251Cmostly conserved

287Tvariable

371Amostly conserved

384Tmostly conserved

392Cvariable

401Gmostly conserved

426Cmostly conserved

458Amostly conserved

503Tvariable

506Amostly conserved

509Amostly conserved

521Amostly conserved

525Tmostly conserved

537Cmostly conserved

ATGTAGTAGTAACTGCTCACGGGTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGGGGATTCGGAAACTGATTAGTGCCTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 52 variants.

Diversity (π)1.9%

Haplotypes52

BINs2

Most divergent pair20.3%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Loligo reynaudiisame genus5.2%Loligo forbesiisame genus10.0%Uroteuthis duvauceliisame family12.4%Alloteuthis africanasame family13.5%Loliolus hardwickeisame family14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type15 432 records

Wild obs. + sensor4 013

Museum / vouchered825

Fossil1

Other10 593

Range

Area of Occupancy AOO11 888 km²

Depth

0–200 m sunlit8 439

200–1000 m twilight74

1–4 km midnight0

>4 km abyssal0

median 23 m · max 733 m · 8 513 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 632≤1 km 440≤10 km 1 170>10 km 39

2 281 georeferenced · 1 732 without coordinates

Open the mapobservation + sensor4 013

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 1≤1 km 5≤10 km 13>10 km 23

42 georeferenced · 783 without coordinates

Open the institutions mapphysical evidence825

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	332
ICATMARlocation not on record	141
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	84
Museu Nacional de História Natural e da Ciêncialocation not on record	6
UM-RSMASlocation not on record	6
Cambridge, US	5
Barcelona, ES	4
Frankfurt am Main	4
Washington, US	3
UGent-MARBIOLlocation not on record	3
Ilvolocation not on record	3
Tel Aviv Universitylocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
Vlaams Instituut voor de Zeelocation not on record	2
IEO-COMA-CSIClocation not on record	2
DASSHlocation not on record	2
ICM-CSIClocation not on record	1
Philadelphia, US	1
CASlocation not on record	1
South Kensington, GB	1
Provincia di Livornolocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
MZLUlocation not on record	1
Brussels, BE	1
CLOlocation not on record	1
730location not on record	1
Marine Biological Association of the UKlocation not on record	1
IEOlocation not on record	1
Gothenburg, SE	1

29 institutions · 616 of 825 vouchered records shown · 17 without an institution code

09Environmental DNA113 detections

Where the DNA of Loligo vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found113

Studies independent surveys2

Countries7

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 113 detections have coordinates

Open the map7 countries0

MarineSandy bottombroken shell and sandNorth Sea

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 6.20–18.6

Seasonal swing summer↔winter13.5 °C

Max temp (day)15.7 °C 9.70–20.6

Min temp (night)5.10 °C 3.20–17.6

Precipitation65.2 mm/mo 20.9–191

Air humidity61.4 % 54.3–64.5

Moisture balance29.9 mm/mo

Vapour deficit675 Pa 356–810

Wind speed4.80 m/s

Cloud cover39.0 % 34.3–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Loligo vulgaris

At a glance

Sources10 archives

Size & morphology2

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type15 432 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type15 432 records